Caloria elegans

(Alder & Hancock, 1845) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Facelinidae/Caloria

At a glance

Occurrence records306

Data sources8

Biological traits2

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Caloria elegans's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

OBISOcean Biodiversity Information System21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS306 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Caloria elegans is a species of colorful sea slug, an aeolid nudibranch, a marine gastropod mollusc in the family Facelinidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caloria elegans has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes3

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes2

BINs2

Most divergent pair3.0%

Where individuals differ — all 18 variable positions, in barcode order

10Tvariable

159Avariable

168Cmostly conserved

201Tmostly conserved

216Amostly conserved

258Tmostly conserved

261Amostly conserved

277Tmostly conserved

321Tmostly conserved

372Cmostly conserved

400Tmostly conserved

408Gmostly conserved

417Cmostly conserved

438Cmostly conserved

450Cmostly conserved

495Gmostly conserved

591Cmostly conserved

597Gmostly conserved

TGATGTGGTTTAGCTGGTACAGGACTTAGACTACTAATTCGATTTGAGTTAGGAACAGCTGGTGCTCTCTTAGGGGATGATCATCTATAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Caloria quatrefagesisame genus14.8%Caloria indicasame genus15.0%Coryphella gracilissame order15.5%Sakuraeolis enosimensissame family16.8%Berghia norvegicasame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type306 records

Wild obs. + sensor284

Museum / vouchered18

Other4

Range

Area of Occupancy AOO488 km²

Depth

0–200 m sunlit13

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20.5 m · max 31.5 m · 13 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 112≤1 km 55≤10 km 28>10 km 3

198 georeferenced · 86 without coordinates

Open the mapobservation + sensor284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
CASlocation not on record	1
Paris, FR	1

3 institutions · 3 of 18 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Caloria elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.3–16.0

Seasonal swing summer↔winter16.7 °C

Max temp (day)18.6 °C 17.4–19.8

Min temp (night)12.1 °C 9.60–14.5

Precipitation41.3 mm/mo 35.0–47.7

Air humidity56.8 % 53.7–60.0

Vapour deficit846 Pa 760–932

Cloud cover41.6 % 38.9–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)