Azanus natalensis

(Trimen, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Azanus

At a glance

Occurrence records1 278

Data sources8

Biological traits0

DNA specimens12

eDNA detections14

Sources8 archives

Databases and archives Azanus natalensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 278 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 278 records

Environmental DNA1 datasets · 3 countries14 detections

DNA & barcodingBOLD12 specimens

01Narrative

Azanus natalensis, the Natal babul blue or Natal spotted blue, is a butterfly of the family Lycaenidae. It is found in the Afrotropical realm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Azanus natalensis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.45%

Haplotypes1

BIN1

Where individuals differ — all 12 variable positions, in barcode order

24Tmostly conserved

49Tmostly conserved

114Tmostly conserved

234Cmostly conserved

270Cmostly conserved

289Gmostly conserved

400Cmostly conserved

456Tmostly conserved

465Amostly conserved

555Gmostly conserved

561Gmostly conserved

621Tmostly conserved

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATTATAATTCGAATAGAATTAGGAACTCCTAGAGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Azanus mirzasame genus3.0%Azanus sitalcessame genus3.0%Azanus jesoussame genus3.5%Azanus soalalicussame genus4.3%Rhamma comstockisame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 278 records

Wild obs. + sensor951

Museum / vouchered327

Range

Area of Occupancy AOO2 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 274≤1 km 163≤10 km 42>10 km 17

496 georeferenced · 455 without coordinates

Open the mapobservation + sensor951

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 4≤10 km 25>10 km 9

38 georeferenced · 289 without coordinates

Open the institutions mapphysical evidence327

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Teylers Museumlocation not on record	112
Durban Natural Science Museumlocation not on record	95
DNSMlocation not on record	26
New Haven, US	24
Sydney, AU	22
Cambridge, US	14
KwaZulu-Natal Museumlocation not on record	13
Iziko South African Museumlocation not on record	10
Cape Town, ZA	6
East London Museumlocation not on record	3
NTNU University Museum, Department of Natural Historylocation not on record	1

11 institutions · 326 of 327 vouchered records shown · 1 without an institution code

09Environmental DNA14 detections

Where the DNA of Azanus natalensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map3 countries0

3. Shrubland | 3.6. Subtropical/Tropical Moi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 16.7–22.5

Seasonal swing summer↔winter2.90 °C

Max temp (day)26.5 °C 21.5–27.5

Min temp (night)14.2 °C 11.8–16.9

Precipitation110 mm/mo 31.9–127

Air humidity55.2 % 52.7–64.7

Moisture balance-60.4 mm/mo -95.9–1.90

Vapour deficit1,113 Pa 672–1,191

Wind speed3.70 m/s 2.10–4.30

Cloud cover26.0 % 17.6–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Azanus natalensis

At a glance

Sources8 archives

At a glance

Record type1 278 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 278 records