Azanus jesous

(Guérin-Méneville, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Azanus

At a glance

Occurrence records5 588

Data sources8

Biological traits0

DNA specimens28

eDNA detections110

Sources8 archives

Databases and archives Azanus jesous's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 588 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 588 records

Environmental DNA1 datasets · 8 countries110 detections

DNA & barcodingBOLD28 specimens

01Narrative

Azanus jesous, the African babul blue or topaz-spotted blue, is a small butterfly found in Africa, Egypt, Syria, India, Sri Lanka and Myanmar that belongs to the lycaenids or blues family.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Azanus jesous has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections110

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

52Amostly conserved

127Avariable

235Tvariable

358Tvariable

619Avariable

622Amostly conserved

623Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTCTAAGAATTTTAATTCGAATAGAATTAGGAACACCTAGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes4

BIN1

Most divergent pair0.61%

AsiaAfricaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Azanus natalensissame genus3.5%Azanus mirzasame genus3.6%Azanus sitalcessame genus3.6%Azanus soalalicussame genus4.9%Nacaduba biocellatasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 588 records

Wild obs. + sensor4 978

Museum / vouchered610

Range

Area of Occupancy AOO8 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 071≤1 km 484≤10 km 193>10 km 97

1 845 georeferenced · 3 133 without coordinates

Open the mapobservation + sensor4 978

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 12≤10 km 38>10 km 13

63 georeferenced · 547 without coordinates

Open the institutions mapphysical evidence610

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Teylers Museumlocation not on record	251
Durban Natural Science Museumlocation not on record	139
New Haven, US	47
DNSMlocation not on record	45
Iziko South African Museumlocation not on record	25
Cape Town, ZA	18
KwaZulu-Natal Museumlocation not on record	18
Sydney, AU	17
Northern Michigan Universitylocation not on record	10
East London Museumlocation not on record	10
Cambridge, US	7
Tartu, EE	4
ZSMlocation not on record	2
Zürich, CH	2
Natural History Museum Rotterdamlocation not on record	2
Auckland, NZ	1
Bavarian State Collection of Zoologylocation not on record	1
Biology Centre of the Czech Academy of Sciences, Institute of Entomologylocation not on record	1
UMUlocation not on record	1

19 institutions · 601 of 610 vouchered records shown · 9 without an institution code

09Environmental DNA110 detections

Where the DNA of Azanus jesous was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map8 countries0

Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 19.0–25.7

Seasonal swing summer↔winter13.3 °C

Max temp (day)29.2 °C 24.3–30.8

Min temp (night)19.2 °C 11.4–19.3

Precipitation1.00 mm/mo 0.7–81.2

Air humidity57.3 % 48.8–58.8

Moisture balance-172 mm/mo -181–-45.1

Vapour deficit1,302 Pa 955–1,465

Wind speed1.90 m/s 1.90–3.80

Cloud cover11.1 % 11.0–34.9

CHELSA 1981–2010, ~9 km grid, at location & month of 109 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Azanus jesous

At a glance

Sources8 archives

At a glance

Record type5 588 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 588 records