Avatha discolor

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Avatha

At a glance

Occurrence records796

Data sources6

Biological traits0

DNA specimens25

eDNA detections24

Sources6 archives

Databases and archives Avatha discolor's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility796 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF796 records

Environmental DNA1 datasets · 1 countries24 detections

DNA & barcodingBOLD25 specimens

01Narrative

Avatha discolor Poole, R. W. (1989). Lepidopterorum Catalogus (New Series) Fascicle 118, Noctuidae . CRC Press. , is a species of moth of the family Erebidae. It is found from the Indo-Australian and Pacific tropics to as far east as Henderson Island.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Avatha discolor has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections24

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

20Gmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTTTACTTATTCGTGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes5

BIN1

Most divergent pair0.46%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Avatha novoguineanasame genus4.9%Ercheia dubiasame family6.5%Anereuthina renosasame family6.7%Smyra aexoniasame family7.0%Lascoria aonsame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type796 records

Wild obs. + sensor758

Museum / vouchered38

Origin

Native1

Range

Area of Occupancy AOO920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 292≤1 km 292≤10 km 20>10 km 29

633 georeferenced · 125 without coordinates

Open the mapobservation + sensor758

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	14
tesrilocation not on record	10
Auckland, NZ	2
National Museums of Kenyalocation not on record	2
SUVlocation not on record	1
Tallinn, EE	1
Helsinki, FI	1
Research Collection of Graeme V. Cockslocation not on record	1

8 institutions · 32 of 38 vouchered records shown · 6 without an institution code

09Environmental DNA24 detections

Where the DNA of Avatha discolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 19.1–24.7

Seasonal swing summer↔winter8.60 °C

Max temp (day)27.1 °C 23.8–29.4

Min temp (night)18.5 °C 16.5–22.0

Precipitation77.8 mm/mo 24.6–177

Air humidity59.4 % 56.3–63.2

Moisture balance-48.7 mm/mo -105–21.0

Vapour deficit1,097 Pa 899–1,291

Wind speed3.20 m/s 1.70–3.80

Cloud cover30.8 % 25.6–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)