Anereuthina renosa

Hübner, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anereuthina

At a glance

Occurrence records36

Data sources7

Biological traits0

DNA specimens7

eDNA detections8

Sources7 archives

Databases and archives Anereuthina renosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF36 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anereuthina renosa is a species of moth of the family Erebidae. It is found in Sundaland, the Philippines and Burma. The habitat consists of hill dipterocarp forests, lower montane forests and lowland forests. The forewings are caramel brown, variably traversed by pale mauve fasciation. There is usually a marking in the centre of the forewing, that may consist of two small black or fawn ellipses or a disc. The hindwings are duller brown. The larvae feed on Elaeis species. Pupation takes place in a silken cocoon within a leaf.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anereuthina renosa has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

10Tmostly conserved

13Tmostly conserved

67Tvariable

112Cvariable

200Avariable

208Avariable

211Amostly conserved

220Cvariable

235Tvariable

343Cvariable

391Avariable

397Cvariable

400Tvariable

427Cvariable

451Tvariable

478Tmostly conserved

490Tmostly conserved

514Avariable

541Tvariable

604Tvariable

622Tmostly conserved

628Amostly conserved

653Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTACTTATTCGTGCTGAACTTGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes3

BINs2

Most divergent pair3.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea illustratasame family5.8%Ercheia dubiasame family6.2%Achaea indeterminatasame family6.4%Achaea albiciliasame family6.6%Avatha discolorsame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type36 records

Wild obs. + sensor34

Museum / vouchered2

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 14≤1 km 8>10 km 4

26 georeferenced · 8 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1
Centre for Biodiversity Genomicslocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Anereuthina renosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 25.0–26.0

Seasonal swing summer↔winter1.20 °C

Max temp (day)28.8 °C 28.5–28.9

Min temp (night)21.5 °C 21.2–23.2

Precipitation286 mm/mo 182–407

Air humidity68.1 % 67.5–71.7

Moisture balance177 mm/mo 52.0–252

Vapour deficit1,034 Pa 903–1,049

Wind speed1.30 m/s 0.9–1.40

Cloud cover66.3 % 52.8–74.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)