Automeris zugana

Druce, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Automeris

At a glance

Occurrence records1 046

Data sources7

Biological traits0

DNA specimens28

eDNA detections3

Sources7 archives

Databases and archives Automeris zugana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 046 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 046 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD28 specimens

01Narrative

Automeris zugana is a moth of the family Saturniidae first described by Herbert Druce in 1886. It is found from Panama to western Ecuador. The habitat consists of hyperhumid tropical rain forests at altitudes between 60 and 1,400 meters."Automeris zugana Druce male". Colombian Insects. The larvae feed on Quercus and Salix species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Automeris zugana has left across the world's sequence archives.

At a glance

DNA specimens28

BINs5

Marker genes1

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

136Cmostly conserved

169Tmostly conserved

172Cmostly conserved

226Tvariable

319Tmostly conserved

334Cvariable

355Tvariable

367Tvariable

373Amostly conserved

409Amostly conserved

418Cvariable

427Tvariable

451Tvariable

454Tmostly conserved

472Gmostly conserved

478Tmostly conserved

484Cvariable

508Cmostly conserved

529Cvariable

562Amostly conserved

583Amostly conserved

613Tmostly conserved

631Avariable

637Cmostly conserved

649Avariable

653Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes11

BINs5

Most divergent pair4.6%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Automeris tolimaiensissame genus1.8%Automeris cundinamarcensissame genus2.4%Automeris magdalenianasame genus2.6%Automeris parapichinchensissame genus3.3%Automeris zozinesame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 046 records

Wild obs. + sensor288

Museum / vouchered758

Origin

Native1

Range

Area of Occupancy AOO948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 178≤1 km 50≤10 km 16>10 km 9

253 georeferenced · 35 without coordinates

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 755 without coordinates

Open the institutions mapphysical evidence758

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	748
Area de Conservacion Guanacastelocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
University of Pennsylvanialocation not on record	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1

5 institutions · 757 of 758 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Automeris zugana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 18.9–24.5

Seasonal swing summer↔winter2.00 °C

Max temp (day)23.5 °C 22.8–27.2

Min temp (night)16.9 °C 15.6–22.2

Precipitation180 mm/mo 175–474

Air humidity69.1 % 68.9–74.1

Moisture balance42.2 mm/mo 34.6–356

Vapour deficit674 Pa 579–952

Wind speed2.10 m/s 1.40–2.70

Cloud cover22.6 % 14.7–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Automeris zugana

At a glance

Sources7 archives

At a glance

Record type1 046 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 046 records