Automeris zozine

Druce, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Automeris

At a glance

Occurrence records273

Data sources7

Biological traits0

DNA specimens21

eDNA detections12

Sources7 archives

Databases and archives Automeris zozine's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF273 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD21 specimens

01Narrative

Automeris zozine is a moth of the family Saturniidae. It is found in Mexico, south to Guatemala and Colombia. The wingspan is about 65 mm. The larvae feed on Quercus and Robinia species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Automeris zozine has left across the world's sequence archives.

At a glance

DNA specimens21

BINs3

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

19Cvariable

43Gvariable

85Cvariable

106Cvariable

127Tmostly conserved

145Tmostly conserved

169Tmostly conserved

172Cvariable

193Tmostly conserved

197Cmostly conserved

200Avariable

202Tmostly conserved

217Avariable

220Tmostly conserved

262Amostly conserved

271Tvariable

283Tmostly conserved

313Cmostly conserved

319Tvariable

340Cmostly conserved

343Cmostly conserved

358Cvariable

364Cvariable

379Amostly conserved

394Tmostly conserved

400Amostly conserved

427Tvariable

451Tvariable

457Cvariable

487Tmostly conserved

493Gmostly conserved

517Tvariable

539Tmostly conserved

541Amostly conserved

628Avariable

634Cvariable

637Cvariable

643Tvariable

646Tmostly conserved

652Cmostly conserved

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTTGGGACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes7

BINs3

Most divergent pair5.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Automeris tuxlanasame genus1.7%Automeris zoziboucardisame genus2.1%Automeris nogueiraisame genus2.7%Automeris tolimaiensissame genus4.1%Automeris zuganasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type273 records

Wild obs. + sensor10

Museum / vouchered194

Other69

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 4≤1 km 1>10 km 1

6 georeferenced · 4 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 125≤1 km 5≤10 km 46>10 km 7

183 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence194

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	130
New Haven, US	48
Tapachula, MX	8
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
South Kensington, GB	2
Universidad del Valle de Guatemalalocation not on record	1
Denver, US	1
Research Collection of Eric Van Schaycklocation not on record	1

8 institutions · 193 of 194 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Automeris zozine was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 12.5–18.0

Seasonal swing summer↔winter3.90 °C

Max temp (day)19.7 °C 17.5–22.6

Min temp (night)9.00 °C 7.60–13.7

Precipitation225 mm/mo 141–236

Air humidity64.9 % 63.5–67.3

Moisture balance79.2 mm/mo 29.6–110

Vapour deficit608 Pa 507–673

Wind speed1.80 m/s 1.20–2.50

Cloud cover18.6 % 18.2–31.2

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)