Atta sexdens

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Atta

At a glance

Occurrence records731

Data sources10

Biological traits0

DNA specimens66

eDNA detections66

Sources10 archives

Databases and archives Atta sexdens's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility731 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics66 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF731 records

Environmental DNA1 datasets · 1 countries66 detections

DNA & barcodingBOLD66 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Atta sexdens is a species of leafcutter ant belonging to the tribe Attini, native to the New World, from the southern United States (Texas) to northern Argentina.Discovery Communications Inc. 2002. "Leaf Cutter Ant" (On-line ). Animal Planet. Accessed 03/11/03 at http://animal.discovery.com/fansites/jeffcorwin/carnival/crawler/leafant.html. They are absent from Chile. They cut leaves to provide a substrate for the fungus farms which are their principal source of food. Their societies are among the most complex found in social insects. A. sexdens is an ecologically important species, but also an agricultural pest. Other Atta species, such as Atta texana, Atta cephalotes and others, have similar behavior and ecology.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding66 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atta sexdens has left across the world's sequence archives.

At a glance

DNA specimens66

BINs5

Marker genes2

eDNA detections66

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

22Amostly conserved

31Amostly conserved

34Tmostly conserved

38Tmostly conserved

40Amostly conserved

43Cvariable

46Cmostly conserved

61Cvariable

82Cmostly conserved

85Tmostly conserved

94Amostly conserved

110Amostly conserved

112Cmostly conserved

118Cvariable

157Tmostly conserved

169Tmostly conserved

172Tmostly conserved

181Avariable

208Tmostly conserved

217Tmostly conserved

223Tmostly conserved

232Tvariable

235Cmostly conserved

238Amostly conserved

250Tvariable

259Cmostly conserved

268Avariable

271Tvariable

286Amostly conserved

301Cmostly conserved

307Avariable

310Cmostly conserved

319Tvariable

322Gmostly conserved

328Cvariable

331Avariable

334Cmostly conserved

337Tmostly conserved

340Cvariable

346Avariable

347Cmostly conserved

367Tvariable

373Amostly conserved

376Tmostly conserved

379Amostly conserved

382Cvariable

391Tvariable

412Tmostly conserved

427Tmostly conserved

433Cvariable

448Tmostly conserved

463Tmostly conserved

499Cvariable

508Cmostly conserved

517Tmostly conserved

523Tmostly conserved

529Tmostly conserved

530Avariable

532Tvariable

538Avariable

541Cvariable

547Tvariable

548Cmostly conserved

550Tvariable

553Cmostly conserved

562Amostly conserved

565Tmostly conserved

589Cvariable

596Tmostly conserved

607Amostly conserved

610Cmostly conserved

619Amostly conserved

628Gvariable

634Cmostly conserved

638Amostly conserved

646Cvariable

AATTTTATATTTTATTTTAGCAATCTGATCAGGTTTATTAGGCTCCTCAATAAGTATAATCATTCGATTAGAATTAAGATCCTGTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.1%

Haplotypes8

BINs5

Most divergent pair7.8%

S.AmericaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atta saltensissame genus10.6%Atta colombicasame genus12.6%Atta cephalotessame genus13.5%Atta mexicanasame genus15.1%Adetomyrma goblinsame family17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Atta sexdens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 111×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type731 records

Wild obs. + sensor463

Museum / vouchered268

Range

Area of Occupancy AOO1 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 172≤1 km 84≤10 km 42>10 km 26

324 georeferenced · 139 without coordinates

Open the mapobservation + sensor463

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 3≤1 km 7≤10 km 28>10 km 14

52 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence268

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	164
EL PASO, US	18
Instituto Nacional de Pesquisas da Amazonialocation not on record	17
Universidad de la Amazonia (UniAmazonia)location not on record	8
Universidad del Vallelocation not on record	7
Pontificia Universidad Javeriana (PUJ)location not on record	6
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	6
UFMSlocation not on record	5
Chicago, US	4
US	4
Edmonton, CA	4
Cambridge, US	3
NMOKlocation not on record	3
ASUlocation not on record	3
University of Alabamalocation not on record	2
Champaign, US	2
Bernardino Rivadavia Natural Sciences Museumlocation not on record	1
Lubbock, US	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Washington, US	1

20 institutions · 260 of 268 vouchered records shown · 8 without an institution code

09Environmental DNA66 detections

Where the DNA of Atta sexdens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 16.9–25.2

Seasonal swing summer↔winter9.50 °C

Max temp (day)25.7 °C 21.9–30.1

Min temp (night)16.8 °C 13.2–21.3

Precipitation148 mm/mo 118–187

Air humidity62.8 % 59.2–64.9

Moisture balance50.1 mm/mo -3.50–84.8

Vapour deficit932 Pa 717–1,202

Wind speed1.70 m/s 1.40–2.00

Cloud cover30.9 % 27.2–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)