Atta colombica

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Atta

At a glance

Occurrence records983

Data sources8

Biological traits0

DNA specimens97

eDNA detections55

Sources8 archives

Databases and archives Atta colombica's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility983 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF983 records

Environmental DNA1 datasets · 3 countries55 detections

DNA & barcodingBOLD97 specimens

Genome at a glanceGoaT · NCBI≈291 Mbp

01Narrative

Atta colombica is one of 47 species of leafcutter ants. This species is part of the Attini tribe (the fungus-growing ants).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atta colombica has left across the world's sequence archives.

At a glance

DNA specimens97

BINs1

Marker genes3

eDNA detections55

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

580Amostly conserved

653Cmostly conserved

TATTCTCTATTTTATTTTTGCAATTTGATCAGGCTTACTAGGGTCATCAATAAGGATAATTATCCGATTGGAATTAAGATCATGTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes10

BIN1

Most divergent pair0.76%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atta cephalotessame genus8.9%Atta saltensissame genus12.5%Atta sexdenssame genus12.6%Atta texanasame genus14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★COI-5P3P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Atta colombica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈291 257 934 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atta colombica0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.1% BUSCO

08Occurrence & distribution

Record type983 records

Wild obs. + sensor723

Museum / vouchered260

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 173≤1 km 121≤10 km 37>10 km 17

348 georeferenced · 375 without coordinates

Open the mapobservation + sensor723

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 260 records without

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	140
CASlocation not on record	59
Grupo Prodecolocation not on record	12
Chicago, US	11
Corporación Centro de Investigación en Palma de Aceite - CENIPALMAlocation not on record	3

5 institutions · 225 of 260 vouchered records shown · 35 without an institution code

09Environmental DNA55 detections

Where the DNA of Atta colombica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map3 countries0

Bosque Seco TropicalTropical dry forest1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 25.8–28.5

Seasonal swing summer↔winter1.00 °C

Max temp (day)28.7 °C 28.6–32.9

Min temp (night)24.1 °C 23.3–24.1

Precipitation292 mm/mo 37.8–323

Air humidity72.4 % 50.1–73.4

Moisture balance163 mm/mo -111–185

Vapour deficit900 Pa 900–1,930

Wind speed1.40 m/s 1.30–2.90

Cloud cover42.6 % 41.0–77.7

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)