Atrosalarias holomelas

(Günther, 1872) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Blenniidae/Atrosalarias

At a glance

Occurrence records815

Data sources10

Biological traits7

DNA specimens10

eDNA detections16

Sources10 archives

Databases and archives Atrosalarias holomelas's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility614 records↗

OBISOcean Biodiversity Information System201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS815 records

Environmental DNA2 datasets · 5 countries16 detections

DNA & barcodingBOLD10 specimens

01Narrative

Atrosalarias holomelas, the brown coral blenny, is a species of combtooth blenny native to coral reefs of the southwestern central Pacific Ocean. It grows to a length of 14.5 cm and can be found in the aquarium trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max20 m

Depth min1 m

Vulnerability10

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrosalarias holomelas has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

16Tmostly conserved

25Amostly conserved

31Amostly conserved

34Amostly conserved

58Gmostly conserved

64Gmostly conserved

67Cmostly conserved

97Cmostly conserved

109Tmostly conserved

130Gmostly conserved

202Tmostly conserved

301Gmostly conserved

313Gmostly conserved

325Gmostly conserved

328Gmostly conserved

340Tmostly conserved

352Amostly conserved

385Tmostly conserved

400Tmostly conserved

413Amostly conserved

454Cmostly conserved

478Tmostly conserved

490Gmostly conserved

496Tmostly conserved

529Cmostly conserved

532Tmostly conserved

562Gmostly conserved

595Amostly conserved

604Cmostly conserved

613Cmostly conserved

CCTCTATCTAGTCTTTGGTGCATGAGCCGGAATAGTAGGCACTGCATTAAGCCTACTGATTCGGGCCGAACTAAGCCAGCCTGGGGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes3

BINs2

Most divergent pair0.47%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atrosalarias fuscussame genus3.6%Salarias fasciatussame family13.9%Scombrops boopssame order14.2%Scombrops gilbertisame order14.7%Salarias alboguttatussame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type815 records

Wild obs. + sensor534

Museum / vouchered271

Other10

Range

Area of Occupancy AOO1 008 km²

Depth

0–200 m sunlit75

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 40 m · 75 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 42≤1 km 73≤10 km 13>10 km 4

132 georeferenced · 402 without coordinates

Open the mapobservation + sensor534

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 3≤1 km 47≤10 km 7>10 km 23

80 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence271

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	46
Western Australian Museumlocation not on record	20
Natick, US	12
Museum and Art Gallery of the Northern Territorylocation not on record	10
Washington, US	5
Curtin Universitylocation not on record	4
CSIRO Oceans and Atmospherelocation not on record	2
Wuzhou, CN	2
	2
Australian National Fish Collectionlocation not on record	2
Chicago, US	2
CASlocation not on record	1
Museums Victorialocation not on record	1
Frankfurt am Main	1
South African Institute for Aquatic Biodiversitylocation not on record	1

15 institutions · 111 of 271 vouchered records shown · 8 without an institution code

09Environmental DNA16 detections

Where the DNA of Atrosalarias holomelas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

Coral reefSeagrass bed

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.7 °C 25.1–27.8

Seasonal swing summer↔winter3.20 °C

Max temp (day)28.2 °C 25.7–28.5

Min temp (night)26.9 °C 24.2–26.9

Precipitation44.0 mm/mo 41.8–329

Air humidity63.9 % 63.4–64.8

Moisture balance-156 mm/mo

Vapour deficit1,333 Pa 1,187–1,367

Wind speed4.20 m/s

Cloud cover35.9 % 32.7–64.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)