Atrosalarias fuscus

(Rüppell, 1838) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Blenniidae/Atrosalarias

At a glance

Occurrence records414

Data sources11

Biological traits6

DNA specimens5

eDNA detections6

Sources11 archives

Databases and archives Atrosalarias fuscus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility179 records↗

OBISOcean Biodiversity Information System235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.74 Gbp↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS414 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT743 Mbp

01Narrative

Atrosalarias fuscus, also known as the dusky blenny, brown coral blenny or black blenny, is a species of marine fish in the family Blenniidae. It is widespread throughout the tropical waters of the Indian Ocean, Red Sea included. This fish is a small size that can reach a maximum size of 14.5 cm length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max12 m

Depth min2 m

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrosalarias fuscus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs4

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)3.5%

Haplotypes1

BINs3

Where individuals differ — all 41 variable positions, in barcode order

31Gmostly conserved

34Amostly conserved

37Avariable

55Amostly conserved

58Tmostly conserved

64Amostly conserved

67Tmostly conserved

88Cvariable

106Avariable

109Cmostly conserved

130Amostly conserved

169Cmostly conserved

175Cvariable

193Amostly conserved

196Avariable

202Tmostly conserved

214Tmostly conserved

241Amostly conserved

265Cvariable

286Cmostly conserved

313Amostly conserved

337Tmostly conserved

340Cmostly conserved

352Avariable

370Tmostly conserved

379Amostly conserved

382Cvariable

383Cmostly conserved

385Tmostly conserved

391Cvariable

400Tmostly conserved

409Amostly conserved

493Tmostly conserved

511Avariable

529Cmostly conserved

533Cvariable

574Gmostly conserved

580Cmostly conserved

583Cmostly conserved

589Avariable

613Tvariable

CCTCTATCTAGTCTTTGGTGCATGAGCCGGGATAGTAGGCACTGCATTAAGCCTACTTATTCGAGCTGAACTAAGCCAGCCTGGGGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atrosalarias holomelassame genus3.6%Salarias alboguttatussame family14.9%Opisthocentrus tenuissame order15.2%Parabembras curtussame order15.2%Callochromis macropssame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Atrosalarias fuscus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size743 280 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atrosalarias fuscus0.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type414 records

Wild obs. + sensor101

Museum / vouchered312

Other1

Origin

Native12

Range

Area of Occupancy AOO704 km²

Depth

0–200 m sunlit38

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 21.3 m · 38 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 3≤1 km 7≤10 km 24>10 km 10

44 georeferenced · 57 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 11≤1 km 13≤10 km 66>10 km 17

107 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence312

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	26
Toronto, CA	18
CASlocation not on record	17
Los Angeles, US	12
South African Institute for Aquatic Biodiversitylocation not on record	5
FishBaselocation not on record	3
Paris, FR	3
KAUMMlocation not on record	2
Honolulu, US	2
Ann Arbor, US	2
Frankfurt am Main	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
New Haven, US	1
Cambridge, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Yokosuka City Museumlocation not on record	1
University of California San Diegolocation not on record	1
	1
Australian Museum, Sydneylocation not on record	1
Copenhagen, DK	1
Chicago, US	1

21 institutions · 102 of 312 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Atrosalarias fuscus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 24.3–26.6

Seasonal swing summer↔winter3.80 °C

Max temp (day)27.7 °C 25.1–30.1

Min temp (night)23.7 °C 18.6–25.6

Precipitation13.0 mm/mo 10.7–185

Air humidity60.2 % 41.3–63.3

Vapour deficit1,266 Pa 1,204–2,116

Cloud cover42.0 % 18.2–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)