Athalia cordata

Serville, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Athalia

At a glance

Occurrence records3 198

Data sources10

Biological traits0

DNA specimens199

eDNA detections542

Sources10 archives

Databases and archives Athalia cordata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI542 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics199 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 198 records

Environmental DNA4 datasets · 19 countries542 detections

DNA & barcodingBOLD199 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈169 Mbp

01Narrative

Athalia cordata is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding199 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Athalia cordata has left across the world's sequence archives.

At a glance

DNA specimens199

BINs4

Marker genes1

eDNA detections542

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus184 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

42Cmostly conserved

48Cmostly conserved

53Cmostly conserved

56Gmostly conserved

62Cmostly conserved

81Gmostly conserved

104Tmostly conserved

108Gmostly conserved

131Tmostly conserved

134Cmostly conserved

137Tmostly conserved

155Cmostly conserved

221Cmostly conserved

269Tmostly conserved

276Cmostly conserved

320Amostly conserved

326Gmostly conserved

338Tmostly conserved

359Cmostly conserved

362Cmostly conserved

368Tmostly conserved

413Tmostly conserved

422Cmostly conserved

431Amostly conserved

485Cmostly conserved

497Tmostly conserved

554Gmostly conserved

555Cmostly conserved

626Tmostly conserved

639Cmostly conserved

644Tmostly conserved

650Tmostly conserved

CACTATATTTTATCATTGGATTCTGATCAGGAATACTTGGACTATCACTAAGCATGATTATCCGAAGAGAATTAAGATCAGCAAATTCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes9

BINs4

Most divergent pair12.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Athalia kashmirensissame genus6.0%Athalia circularissame genus11.1%Athalia ancillasame genus11.8%Athalia rufoscutellatasame genus12.1%Athalia lugenssame genus12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Athalia cordata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈169 026 174 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Athalia cordata0.17 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records6–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 123×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 61×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.8% BUSCO

08Occurrence & distribution

Record type3 198 records

Wild obs. + sensor2 651

Museum / vouchered545

Cultivated / captive2

Range

Area of Occupancy AOO7 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 1 302≤1 km 586≤10 km 462>10 km 26

2 376 georeferenced · 275 without coordinates

Open the mapobservation + sensor2 651

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 227≤1 km 49≤10 km 101>10 km 4

381 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence545

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	65
SLU Artdatabankenlocation not on record	52
BioFokuslocation not on record	50
NHMOlocation not on record	45
NCMGlocation not on record	34
Stockholm, SE	28
Institute of Zoology Slovak Academy of Scienceslocation not on record	24
Tromsø, NO	23
ZSMlocation not on record	17
DFFW2018location not on record	15
Helsinki, FI	13
Tilburg, NL	13
Oulu, FI	9
neflocation not on record	7
UGRlocation not on record	5
DFlocation not on record	5
Natural History Museum, Londonlocation not on record	5
Philadelphia, US	3
Muzeum Górnośląskie w Bytomiulocation not on record	3
IMEDEAlocation not on record	2
NTNU-VMlocation not on record	2
Natural History Museum Rotterdamlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

23 institutions · 422 of 545 vouchered records shown · 123 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA542 detections

Where the DNA of Athalia cordata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found542

Studies independent surveys4

Countries19

Verifiable raw sequence linked322

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 542 detections have coordinates

Open the map19 countries0

Mediterranean forest1.1. Boreal Forest|1. Forest & Woodland14. Artificial - Terrestrial | 14.5 Urban Ar…Sandtak med store omrader som ikke er i akti…1. Forest & Woodland | 1.4. Temperate Forestlisiere maquis aulnaie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 11.4–17.2

Seasonal swing summer↔winter17.9 °C

Max temp (day)19.7 °C 15.2–21.2

Min temp (night)12.4 °C 7.60–13.6

Precipitation73.5 mm/mo 54.5–99.6

Air humidity60.8 % 58.3–63.6

Moisture balance-29.6 mm/mo -60.7–11.2

Vapour deficit696 Pa 534–799

Wind speed3.10 m/s 2.40–4.20

Cloud cover45.0 % 35.1–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 540 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Athalia cordata

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 198 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 198 records