Athalia lugens

(Klug, 1815) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Athalia

At a glance

Occurrence records1 079

Data sources9

Biological traits0

DNA specimens30

eDNA detections107

Sources9 archives

Databases and archives Athalia lugens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 079 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 079 records

Environmental DNA4 datasets · 14 countries107 detections

DNA & barcodingBOLD30 specimens

Genome at a glanceGoaT · TreeOfSex2n = 16

01Narrative

Athalia lugens is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Athalia lugens has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections107

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTATTGGATTTTGATCAGGAATAATTGGATTATCAATAAGATTAATTATTCGAAGAGAATTAAGTTCAACAAATTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Athalia proximasame genus1.5%Athalia cornubiaesame genus8.8%Athalia libertasame genus9.0%Athalia ancillasame genus9.9%Athalia rufoscutellatasame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Athalia lugens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

08Occurrence & distribution

Record type1 079 records

Wild obs. + sensor731

Museum / vouchered348

Range

Area of Occupancy AOO2 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 331≤1 km 103≤10 km 229>10 km 2

665 georeferenced · 66 without coordinates

Open the mapobservation + sensor731

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 180≤1 km 25≤10 km 40>10 km 3

248 georeferenced · 100 without coordinates

Open the institutions mapphysical evidence348

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	69
BioFokuslocation not on record	51
Helsinki, FI	25
Tilburg, NL	20
DFFW2018location not on record	18
ZSMlocation not on record	12
Stockholm, SE	11
Zürich, CH	10
SLU Artdatabankenlocation not on record	8
DFlocation not on record	7
neflocation not on record	6
NEFlocation not on record	4
NCMGlocation not on record	4
Natural History Museum Rotterdamlocation not on record	3
Oulu, FI	2
Bonn, DE	2
South Kensington, GB	2
MZLUlocation not on record	2
Metsähallituslocation not on record	1
Tromsø, NO	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

22 institutions · 260 of 348 vouchered records shown · 88 without an institution code

09Environmental DNA107 detections

Where the DNA of Athalia lugens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys4

Countries14

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map14 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.4. Temperate Forest8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 13.5–24.0

Seasonal swing summer↔winter19.2 °C

Max temp (day)22.4 °C 16.3–28.3

Min temp (night)14.2 °C 9.50–18.4

Precipitation99.6 mm/mo 34.2–198

Air humidity62.4 % 57.3–68.0

Moisture balance-3.20 mm/mo -71.7–109

Vapour deficit754 Pa 608–1,267

Wind speed2.90 m/s 1.60–4.60

Cloud cover44.1 % 25.2–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Athalia lugens

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 079 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 079 records