Ariadnaria insignis

(Middendorff, 1848) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Capulidae/Ariadnaria

At a glance

Occurrence records87

Data sources7

Biological traits5

DNA specimens12

eDNA detections11

Sources7 archives

Databases and archives Ariadnaria insignis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

OBISOcean Biodiversity Information System33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS87 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Ariadnaria insignis is een slakkensoort uit de familie van de Capulidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1848 door Middendorff.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max695 m

Depth min695 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariadnaria insignis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

235Tmostly conserved

421Amostly conserved

TACAATATATATCCTTTTTAGAATATGATCAGGTCTAGTAGGAACTGCCTTAAGACTTTTAATTCGAGCTGAGCTAGCACAACCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trichotropis cancellatasame family7.9%Ariadnaria borealissame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type87 records

Wild obs. + sensor30

Museum / vouchered57

Range

Area of Occupancy AOO156 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 22.8 m · max 37.5 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 5

6 georeferenced · 24 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Santa Barbara Museum of Natural Historylocation not on record	3
National Marine Biodiversity Institute of Korealocation not on record	2
Denver, US	1
Cambridge, US	1
Wakayama Prefectural Museum of Natural Historylocation not on record	1
Florida Museum of Natural Historylocation not on record	1
Bando, JP	1
Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoologylocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1
Seattle, US	1

12 institutions · 26 of 57 vouchered records shown · 11 without an institution code

09Environmental DNA11 detections

Where the DNA of Ariadnaria insignis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.90 °C 1.20–8.60

Seasonal swing summer↔winter17.6 °C

Max temp (day)9.00 °C 2.60–10.2

Min temp (night)3.10 °C -0.1–7.40

Precipitation51.3 mm/mo 51.3–141

Air humidity63.0 % 63.0–67.3

Moisture balance-45.8 mm/mo -45.8–85.3

Vapour deficit370 Pa 235–370

Wind speed3.70 m/s 3.70–5.50

Cloud cover39.5 % 39.5–64.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)