Ariadnaria borealis

(Broderip & G.B.Sowerby I, 1829) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Capulidae/Ariadnaria

At a glance

Occurrence records1 893

Data sources7

Biological traits5

DNA specimens20

eDNA detections15

Sources7 archives

Databases and archives Ariadnaria borealis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 504 records↗

OBISOcean Biodiversity Information System389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS1 893 records

Environmental DNA1 datasets · 3 countries15 detections

DNA & barcodingBOLD20 specimens

01Narrative

Trichotropis conica is a species of small sea snail, a marine gastropod mollusk in the family Capulidae, the cap snails.MolluscaBase (2020). MolluscaBase. Trichotropis conica Møller, 1842. Accessed through: World Register of Marine Species at: http://www.marinespecies.org/aphia.php?p=taxdetails&id=750594 on 2020-01-07

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max944 m

Depth min2 m

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariadnaria borealis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

5Amostly conserved

85Gvariable

88Gvariable

91Tvariable

139Gvariable

169Tvariable

172Gvariable

187Tvariable

197Tmostly conserved

220Cvariable

244Amostly conserved

250Cvariable

271Tvariable

292Gmostly conserved

316Amostly conserved

325Tvariable

328Gvariable

337Cvariable

346Gvariable

358Tvariable

382Tvariable

385Cmostly conserved

400Avariable

463Tvariable

469Avariable

484Gvariable

505Tvariable

512Gvariable

523Avariable

550Avariable

553Gvariable

557Tvariable

574Tvariable

577Avariable

643Gvariable

649Avariable

TACAATATATATCCTTTTTAGAATATGATCAGGCTTAGTAGGTACAGCTTTAAGGCTATTAATTCGGGCTGAATTGGCACAGCCGGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes5

BINs2

Most divergent pair4.9%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trichotropis cancellatasame family13.0%Ariadnaria insignissame genus14.6%Capulus danielisame family17.4%Tritonoharpa antiquatasame order17.5%Anentome helenasame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 893 records

Wild obs. + sensor821

Museum / vouchered899

Fossil1

Other172

Range

Area of Occupancy AOO3 900 km²

Depth

0–200 m sunlit278

200–1000 m twilight55

1–4 km midnight0

>4 km abyssal0

median 46.6 m · max 650 m · 333 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 654≤1 km 8≤10 km 1

663 georeferenced · 158 without coordinates

Open the mapobservation + sensor821

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 115≤1 km 78≤10 km 29>10 km 39

261 georeferenced · 638 without coordinates

Open the institutions mapphysical evidence899

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	233
Tromsø, NO	143
NTNU-VMlocation not on record	129
Cambridge, US	55
Norwegian Institute of Marine Researchlocation not on record	34
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	32
Natural History Museum Rotterdamlocation not on record	22
Bergen, NO	12
RBINS-Scientific Heritagelocation not on record	9
Brussels, BE	9
Maurice Lamontagne Institutelocation not on record	8
Philadelphia, US	8
Gothenburg, SE	7
DASSHlocation not on record	6
NHMOlocation not on record	6
PNHSlocation not on record	6
Helsinki, FI	4
Frankfurt am Main	4
University of Oslo, Natural History Museumlocation not on record	3
Denver, US	2
Chicago, US	2
University Museum of Bergen, Natural History Collectionslocation not on record	1
CEFASlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Paleontological Research Institutionlocation not on record	1
NIMRDlocation not on record	1
Saint John, CA	1

27 institutions · 740 of 899 vouchered records shown · 45 without an institution code

09Environmental DNA15 detections

Where the DNA of Ariadnaria borealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

9. Marine - NeriticMarine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 5.60–7.20

Seasonal swing summer↔winter43.0 °C

Max temp (day)10.8 °C 6.50–10.8

Min temp (night)3.80 °C 3.60–4.70

Precipitation43.1 mm/mo 43.1–97.7

Air humidity62.0 % 60.0–62.0

Moisture balance-25.4 mm/mo

Vapour deficit387 Pa 345–407

Wind speed4.60 m/s

Cloud cover61.5 % 50.9–61.5

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ariadnaria borealis

At a glance

Sources7 archives

Size & morphology1

Habitat & environment2

Other traits2

At a glance

Record type1 893 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 893 records