Arhyssus scutatus

(Stål, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhopalidae/Arhyssus

At a glance

Occurrence records90

Data sources7

Biological traits0

DNA specimens49

eDNA detections91

Sources7 archives

Databases and archives Arhyssus scutatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility90 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI91 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF90 records

Environmental DNA1 datasets · 2 countries91 detections

DNA & barcodingBOLD49 specimens

01Narrative

Arhyssus scutatus is a species of scentless plant bug in the family Rhopalidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhyssus scutatus has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections91

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

49Amostly conserved

85Tmostly conserved

97Gmostly conserved

259Amostly conserved

340Gmostly conserved

497Tmostly conserved

580Gmostly conserved

643Cvariable

ATTATACTTTATTTTTGGTATATGAGCAGGAATAGTAGGATCATCCCTAAGATGAATTATTCGTGTAGAGTTAGGGCAACCGGGTTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes6

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhyssus distinctussame genus5.8%Arhyssus lateralissame genus12.3%Arhyssus rubrovenosussame genus12.9%Aufeius impressicollissame family13.5%Dicranocephalus mediussame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type90 records

Wild obs. + sensor1

Museum / vouchered89

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
Royal Saskatchewan Museumlocation not on record	19
Mexico City, MX	6
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	4
Universidad Católica de Manizaleslocation not on record	3
Centre for Biodiversity Genomicslocation not on record	2
US	2
Champaign, US	2
Durango, MX	1

9 institutions · 59 of 89 vouchered records shown · 30 without an institution code

09Environmental DNA91 detections

Where the DNA of Arhyssus scutatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found91

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 91 detections have coordinates

Open the map2 countries0

Mixed habitatGrassland4. Native Grassland4. Native Grassland | 4.4. Temperate GrasslandHay1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.2–20.3

Seasonal swing summer↔winter23.9 °C

Max temp (day)20.2 °C 16.4–27.3

Min temp (night)7.00 °C 4.20–13.6

Precipitation54.5 mm/mo 5.40–145

Air humidity52.2 % 44.6–59.2

Moisture balance-51.0 mm/mo -160–31.9

Vapour deficit747 Pa 560–1,252

Wind speed2.90 m/s 1.60–4.20

Cloud cover33.7 % 14.0–39.4

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)