Arhyssus lateralis

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhopalidae/Arhyssus

At a glance

Occurrence records479

Data sources7

Biological traits0

DNA specimens24

eDNA detections1

Sources7 archives

Databases and archives Arhyssus lateralis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility479 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF479 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD24 specimens

01Narrative

Arhyssus lateralis is a species of scentless plant bug in the family Rhopalidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhyssus lateralis has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

7Amostly conserved

13Tmostly conserved

19Tmostly conserved

43Amostly conserved

79Cmostly conserved

88Gmostly conserved

106Cmostly conserved

112Cmostly conserved

118Cvariable

124Tmostly conserved

127Amostly conserved

133Tmostly conserved

142Cmostly conserved

154Cmostly conserved

169Amostly conserved

172Tvariable

181Amostly conserved

211Amostly conserved

223Tmostly conserved

226Cmostly conserved

235Tmostly conserved

238Cmostly conserved

250Tmostly conserved

265Amostly conserved

271Cmostly conserved

277Gmostly conserved

284Tmostly conserved

316Amostly conserved

319Tmostly conserved

322Amostly conserved

334Tmostly conserved

340Tmostly conserved

346Amostly conserved

349Gmostly conserved

359Tmostly conserved

361Amostly conserved

364Tmostly conserved

376Amostly conserved

379Amostly conserved

385Cmostly conserved

391Cmostly conserved

397Tmostly conserved

400Amostly conserved

406Cmostly conserved

421Cmostly conserved

428Tmostly conserved

433Amostly conserved

439Cmostly conserved

445Tmostly conserved

448Tmostly conserved

454Tmostly conserved

469Amostly conserved

478Tmostly conserved

487Tmostly conserved

490Amostly conserved

496Cmostly conserved

499Amostly conserved

520Amostly conserved

526Tmostly conserved

529Tmostly conserved

530Cmostly conserved

533Tmostly conserved

535Amostly conserved

542Tmostly conserved

558Tmostly conserved

568Amostly conserved

578Cvariable

613Tmostly conserved

616Cvariable

622Cmostly conserved

628Gvariable

631Tmostly conserved

634Tmostly conserved

640Cmostly conserved

641Tmostly conserved

643Amostly conserved

646Tvariable

652Cmostly conserved

653Tmostly conserved

658Tmostly conserved

AACTTTATATTTTATTTTTGGTATATGAGCAGGAATAGTCGGATCATCTCTAAGTTGAATTATTCGAGTAGAATTAGGCCAACCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes13

BINs2

Most divergent pair11.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhyssus rubrovenosussame genus1.7%Arhyssus nigristernumsame genus9.8%Aufeius impressicollissame family12.6%Neoneides muticussame order12.7%Leptocoris tagalicussame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type479 records

Wild obs. + sensor10

Museum / vouchered469

Range

Area of Occupancy AOO820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 2

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 13≤1 km 30≤10 km 178>10 km 3

224 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence469

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	193
North Carolina State University Insect Museumlocation not on record	146
US	44
Mexico City, MX	18
Mississippi State, US	17
College Station, US	10
San Francisco, US	7
Universidad Católica de Manizaleslocation not on record	6
Royal Saskatchewan Museumlocation not on record	5
University of Guelphlocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Cambridge, US	1
Lubbock, US	1
CUlocation not on record	1
Chicago, US	1
Cornell University Insect Collectionlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Lake Placid, US	1
University of Central Floridalocation not on record	1

20 institutions · 462 of 469 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Arhyssus lateralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)20.6 °C

Min temp (night)11.8 °C

Precipitation84.6 mm/mo

Air humidity60.3 %

Moisture balance-3.50 mm/mo

Vapour deficit683 Pa

Wind speed3.40 m/s

Cloud cover48.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)