Arhyssus nigristernum

(Signoret, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhopalidae/Arhyssus

At a glance

Occurrence records132

Data sources6

Biological traits0

DNA specimens10

eDNA detections0

Sources6 archives

Databases and archives Arhyssus nigristernum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility132 records↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF132 records

DNA & barcodingBOLD10 specimens

01Narrative

Arhyssus nigristernum is a species of scentless plant bug in the family Rhopalidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhyssus nigristernum has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P559 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes1

BINs2

Where individuals differ — all 16 variable positions, in barcode order

4Tvariable

124Cvariable

142Tvariable

190Tvariable

250Cvariable

316Avariable

322Gvariable

331Avariable

428Cvariable

442Cvariable

469Gvariable

478Gvariable

496Tvariable

499Cvariable

508Cvariable

526Cvariable

AACTTTATATTTCATTTTCGGTATATGAGCAGGAATAGTCGGATCATCTCTAAGTTGAATTATTCGAGTAGAATTAGGTCAACCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhyssus rubrovenosussame genus9.3%Arhyssus lateralissame genus9.8%Coriomeris affinissame order12.6%Coriomeris denticulatussame order13.1%Jalysus wickhamisame order13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type132 records

Wild obs. + sensor9

Museum / vouchered123

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 5≤1 km 1>10 km 2

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 123 records without

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	66
University of Guelphlocation not on record	44
Champaign, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
CUlocation not on record	1

5 institutions · 117 of 123 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)