Arhopala micale

Blanchard, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Arhopala

At a glance

Occurrence records1 449

Data sources5

Biological traits0

DNA specimens12

eDNA detections3

Sources5 archives

Databases and archives Arhopala micale's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 449 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 449 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD12 specimens

01Narrative

Arhopala micale, the common oakblue or shining oakblue, is a butterfly of the family Lycaenidae. The species comprises about 16 subspecies, which are found in Melanesia and New Guinea as well as the north coast of Australia (see subspecies section). The wingspan is about 40 mm. The larvae feed on Buchanania arborescens, Cordia dichotoma, Calophyllum inophyllum, Terminalia muelleri, Glochidion ferdinandi, Cryptocarya hypospodia, Lagerstroemia speciosa, Hibiscus tiliaceus, Acmena, Cupaniopsis anacardioides, Heritiera littoralis and Oxera splendida. They are attended by the ant species Oecophylla smaragdina. When not feeding, the larvae rest in a curled leaf or the entrance to the ants' nest.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhopala micale has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

235Tvariable

577Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATATTAGGAACATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes3

BIN1

Most divergent pair0.30%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhopala centaurussame genus2.4%Arhopala madytussame genus2.9%Arhopala aexonesame genus3.0%Arhopala adherbalsame genus3.0%Arhopala mutasame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 449 records

Wild obs. + sensor742

Museum / vouchered703

Other4

Range

Area of Occupancy AOO1 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 335≤1 km 138≤10 km 32>10 km 38

543 georeferenced · 199 without coordinates

Open the mapobservation + sensor742

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 1≤1 km 5≤10 km 309>10 km 53

368 georeferenced · 335 without coordinates

Open the institutions mapphysical evidence703

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	278
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	103
Cambridge, US	92
Natick, US	79
Australian National Fish Collectionlocation not on record	51
Sydney, AU	31
Museum and Art Gallery of the Northern Territorylocation not on record	23
Auckland, NZ	19
Western Australian Museumlocation not on record	11
Australian National Insect Collectionlocation not on record	4
DPIlocation not on record	4
Cornell University Insect Collectionlocation not on record	2
MZLUlocation not on record	2

13 institutions · 699 of 703 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Arhopala micale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.8 °C 24.6–26.8

Seasonal swing summer↔winter3.00 °C

Max temp (day)27.4 °C 26.5–27.4

Min temp (night)26.0 °C 22.6–26.0

Precipitation258 mm/mo 167–266

Air humidity64.1 % 64.0–64.2

Moisture balance60.3 mm/mo 4.30–74.9

Vapour deficit1,257 Pa 1,107–1,260

Wind speed4.90 m/s 3.70–5.70

Cloud cover69.2 % 43.5–71.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arhopala micale

At a glance

Sources5 archives

At a glance

Record type1 449 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 449 records