Arhopala madytus

Fruhstorfer, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Arhopala

At a glance

Occurrence records484

Data sources6

Biological traits0

DNA specimens6

eDNA detections1

Sources6 archives

Databases and archives Arhopala madytus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility484 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF484 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Arhopala madytus, the bright oakblue, is a butterfly of the family Lycaenidae. The species was first described by Hans Fruhstorfer in 1914.Fruhstorfer, H. (1914). "Neue Arhopala Rassen". Deutsche entomologische Zeitschrift (Iris). 27 (4): 155–166. It is found on New Guinea and adjacent islands (Aru, Ambon, Waigeu, from Western New Guinea to Papua, Woodlark and the Louisiades) and the north-east coast of Queensland, Australia. The wingspan is about 40 mm. The larvae feed on Terminalia catappa, T. melanocarpa, T. sericocarpa and Hibiscus tiliaceus. They are attended by the ant species Oecophylla smaragdina.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhopala madytus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATATTAGGTACATCTCTAAGAATTTTAATTCGAATAGAATTAGGAACTCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhopala aexonesame genus1.5%Arhopala centaurussame genus1.7%Arhopala micalesame genus2.9%Arhopala mutasame genus4.7%Arhopala eumolphussame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type484 records

Wild obs. + sensor300

Museum / vouchered182

Other2

Range

Area of Occupancy AOO668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 132≤1 km 72≤10 km 14>10 km 7

225 georeferenced · 75 without coordinates

Open the mapobservation + sensor300

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 5≤10 km 79>10 km 12

96 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	79
Natick, US	42
Cambridge, US	16
Sydney, AU	16
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	10
Australian National Fish Collectionlocation not on record	6
Auckland, NZ	3
Western Australian Museumlocation not on record	3
Museum and Art Gallery of the Northern Territorylocation not on record	2
New Haven, US	1
Australian National Insect Collectionlocation not on record	1
DPIlocation not on record	1

12 institutions · 180 of 182 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Arhopala madytus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)