Arhopala japonica

(Murray, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Arhopala

At a glance

Occurrence records972

Data sources6

Biological traits0

DNA specimens10

eDNA detections11

Sources6 archives

Databases and archives Arhopala japonica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility972 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF972 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT2n = 48

01Narrative

Arhopala japonica, the Japanese oakblue, is a butterfly of the family Lycaenidae. It is found in Indochina, Japan, the Ryukyu Islands, the Korean Peninsula and Taiwan. The wingspan is 24–30 mm. The larvae feed on Pasania edulis, Pasania glabra, Quercus acuta, Quercus glauca, Quercus serrata, Quercus stenophylla, Cyclobalanopsis glauca, Cyclobalanopsis gilva and Cyclobalanopsis acuta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhopala japonica has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections11

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P547 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

15Tmostly conserved

51Tmostly conserved

57Tmostly conserved

75Cmostly conserved

81Tvariable

90Amostly conserved

105Amostly conserved

108Tmostly conserved

111Tmostly conserved

123Tvariable

129Tmostly conserved

154Cmostly conserved

156Tmostly conserved

159Cvariable

172Tmostly conserved

175Tmostly conserved

181Tmostly conserved

182Cmostly conserved

186Amostly conserved

213Amostly conserved

225Tmostly conserved

237Tmostly conserved

258Tmostly conserved

273Tmostly conserved

288Tmostly conserved

300Tmostly conserved

309Tmostly conserved

312Tmostly conserved

351Tvariable

362Amostly conserved

363Tmostly conserved

366Cmostly conserved

367Tmostly conserved

372Amostly conserved

387Tmostly conserved

402Amostly conserved

429Tmostly conserved

430Tmostly conserved

435Tmostly conserved

444Tmostly conserved

450Amostly conserved

474Tmostly conserved

492Amostly conserved

495Tmostly conserved

498Cmostly conserved

501Cvariable

507Tmostly conserved

510Tmostly conserved

516Avariable

529Tmostly conserved

531Amostly conserved

546Cmostly conserved

TATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes5

BINs2

Most divergent pair8.8%

AsiaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhopala eumolphussame genus4.2%Arhopala mutasame genus4.4%Arhopala centaurussame genus4.9%Arhopala zambrasame genus4.9%Arawacus lincoidessame family5.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Arhopala japonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome records24–482n range36median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 481×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type972 records

Wild obs. + sensor852

Museum / vouchered120

Range

Area of Occupancy AOO1 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 341≤1 km 116≤10 km 28>10 km 60

545 georeferenced · 307 without coordinates

Open the mapobservation + sensor852

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤1 km 5≤10 km 6>10 km 5

16 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	38
Tokushima, JP	17
National Museum of Natural Sciencelocation not on record	10
Cambridge, US	7
Natural History Museum of Utahlocation not on record	3
New Haven, US	3
Tartu, EE	2
Nagatoro-machi, Chichibu-gun, JP	1
Ishikawa Museum of Natural Historylocation not on record	1
Yokosuka City Museumlocation not on record	1
WSUClocation not on record	1

11 institutions · 84 of 120 vouchered records shown · 36 without an institution code

09Environmental DNA11 detections

Where the DNA of Arhopala japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Subtropical forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–18.9

Seasonal swing summer↔winter22.4 °C

Max temp (day)19.9 °C 19.1–22.0

Min temp (night)11.9 °C 11.9–15.1

Precipitation189 mm/mo 189–358

Air humidity59.5 % 59.5–69.4

Moisture balance96.4 mm/mo 96.4–250

Vapour deficit831 Pa 654–831

Wind speed2.10 m/s 1.80–2.30

Cloud cover37.4 % 36.0–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)