Argyrotaenia quercifoliana

(Fitch, 1858) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records4 680

Data sources8

Biological traits0

DNA specimens65

eDNA detections69

Sources8 archives

Databases and archives Argyrotaenia quercifoliana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 680 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics65 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 680 records

Environmental DNA1 datasets · 3 countries69 detections

DNA & barcodingBOLD65 specimens

01Narrative

Argyrotaenia quercifoliana, oak leafroller, size: 8.8 mm Argyrotaenia quercifoliana, the yellow-winged oak leafroller moth, is a species of moth of the family Tortricidae. It is found in eastern North America.Bug Guide The wingspan is 16–24 mm. Adults have pale yellowish-cream forewings with golden-brown speckling and brown, oblique lines. There is a hollow circle pattern in the subterminal area. The hindwings are white with yellow shading in the lower half. Adults are on wing from May to July. The larvae feed on Hamamelis, Quercus (oak), and possibly Rhamnus (buckthorn) species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding65 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia quercifoliana has left across the world's sequence archives.

At a glance

DNA specimens65

BINs1

Marker genes1

eDNA detections69

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus65 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

82Cmostly conserved

103Tmostly conserved

268Amostly conserved

367Cmostly conserved

421Amostly conserved

508Amostly conserved

523Cmostly conserved

562Amostly conserved

AACATTATATTTTATTTTTGGAATCTGATCTGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes20

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia juglandanasame genus5.0%Argyrotaenia alisellanasame genus5.3%Diedra intermontanasame family6.7%Homona mermerodessame family6.8%Pandemis lamprosanasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 680 records

Wild obs. + sensor4 306

Museum / vouchered374

Range

Area of Occupancy AOO7 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2 268≤1 km 771≤10 km 192>10 km 439

3 670 georeferenced · 636 without coordinates

Open the mapobservation + sensor4 306

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤1 km 36≤10 km 45>10 km 6

87 georeferenced · 287 without coordinates

Open the institutions mapphysical evidence374

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	137
Cornell University Insect Collectionlocation not on record	99
St. Paul, US	44
East Lansing, US	22
New Haven, US	20
Royal Saskatchewan Museumlocation not on record	13
North Carolina State University Insect Museumlocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
CUlocation not on record	5
Decorah, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Philadelphia, US	2
Cambridge, US	1
Toronto, CA	1

14 institutions · 365 of 374 vouchered records shown · 9 without an institution code

09Environmental DNA69 detections

Where the DNA of Argyrotaenia quercifoliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map3 countries0

UrbanForestGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 17.4–23.7

Seasonal swing summer↔winter24.3 °C

Max temp (day)25.5 °C 22.6–28.1

Min temp (night)16.0 °C 11.7–18.8

Precipitation94.9 mm/mo 79.2–146

Air humidity59.1 % 56.4–60.1

Moisture balance-49.3 mm/mo -69.2–-17.4

Vapour deficit977 Pa 809–1,177

Wind speed3.20 m/s 2.30–3.90

Cloud cover40.1 % 33.0–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyrotaenia quercifoliana

At a glance

Sources8 archives

At a glance

Record type4 680 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 680 records