Argyrotaenia alisellana

(Robinson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records1 404

Data sources8

Biological traits0

DNA specimens35

eDNA detections31

Sources8 archives

Databases and archives Argyrotaenia alisellana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 404 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 404 records

Environmental DNA1 datasets · 2 countries31 detections

DNA & barcodingBOLD35 specimens

01Narrative

Argyrotaenia alisellana, the white-spotted leafroller, is a moth of the family Tortricidae. It is found from Quebec and Maine to Florida, west to Arkansas, north to North Dakota. The wingspan is 18–25 mm. Adults are on wing from May to September. The larvae feed on the leaves of Quercus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia alisellana has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections31

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

20Gmostly conserved

85Cmostly conserved

151Tmostly conserved

220Tmostly conserved

274Tmostly conserved

500Cmostly conserved

595Cmostly conserved

616Cmostly conserved

652Cvariable

AACACTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes11

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia juglandanasame genus5.2%Argyrotaenia quercifolianasame genus5.3%Argyrotaenia quadrifascianasame genus5.5%Clepsis persicanasame family6.1%Argyrotaenia atimasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 404 records

Wild obs. + sensor1 214

Museum / vouchered190

Range

Area of Occupancy AOO2 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 641≤1 km 225≤10 km 56>10 km 79

1 001 georeferenced · 213 without coordinates

Open the mapobservation + sensor1 214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 22≤10 km 40>10 km 5

67 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence190

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	34
East Lansing, US	32
Cornell University Insect Collectionlocation not on record	25
New Haven, US	22
University of California, Davislocation not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
St. Paul, US	10
North Carolina State University Insect Museumlocation not on record	10
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
Decorah, US	2
Philadelphia, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
OSUClocation not on record	1
Natural History Museum of Utahlocation not on record	1
Cambridge, US	1
UDlocation not on record	1
Colorado State Universitylocation not on record	1
Toronto, CA	1

19 institutions · 174 of 190 vouchered records shown · 16 without an institution code

09Environmental DNA31 detections

Where the DNA of Argyrotaenia alisellana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 17.4–21.7

Seasonal swing summer↔winter24.3 °C

Max temp (day)25.5 °C 22.7–27.0

Min temp (night)15.2 °C 11.7–17.1

Precipitation94.7 mm/mo 73.9–137

Air humidity57.6 % 56.2–59.5

Moisture balance-64.6 mm/mo -68.8–-21.1

Vapour deficit977 Pa 809–1,092

Wind speed3.40 m/s 2.50–3.90

Cloud cover39.0 % 37.0–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyrotaenia alisellana

At a glance

Sources8 archives

At a glance

Record type1 404 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 404 records