Argyrotaenia provana

(Kearfott, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records117

Data sources8

Biological traits0

DNA specimens30

eDNA detections22

Sources8 archives

Databases and archives Argyrotaenia provana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD30 specimens

01Narrative

Argyrotaenia provana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Arizona, British Columbia, California, Colorado, New Mexico, Utah, Washington and Wyoming.mothphotographersgroup The wingspan is about 19 mm. Adults have been recorded on wing from June to October. The larvae feed on Abies concolor, Abies magnifica and Pseudotsuga menziesii.Brown, J. W., G. Robinson & J. A. Powell. 2008. Food plant database of the leafrollers of the world (Lepidoptera: Tortricidae) (Version 1.0)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia provana has left across the world's sequence archives.

At a glance

DNA specimens30

BINs3

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Tmostly conserved

38Gmostly conserved

115Tmostly conserved

127Amostly conserved

160Amostly conserved

211Gmostly conserved

223Amostly conserved

235Tmostly conserved

250Cmostly conserved

265Tmostly conserved

287Tmostly conserved

316Gmostly conserved

355Tmostly conserved

361Cmostly conserved

379Amostly conserved

412Cmostly conserved

442Cmostly conserved

477Amostly conserved

490Cmostly conserved

517Amostly conserved

562Tmostly conserved

571Tmostly conserved

646Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTACTAATTCGTGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes4

BINs3

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Clepsis melaleucanussame family5.6%Argyrotaenia ljungianasame genus6.2%Argyrotaenia hodgesisame genus6.4%Argyrotaenia tabulanasame genus6.4%Argyrotaenia occultanasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type117 records

Wild obs. + sensor36

Museum / vouchered81

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 25≤1 km 4

29 georeferenced · 7 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 3≤1 km 23≤10 km 8

34 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	25
Essig Museum of Entomologylocation not on record	23
New Haven, US	5
Denver, US	5
Mississippi State, US	2
San Francisco, US	2
ASUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Colorado State Universitylocation not on record	1
St. Paul, US	1

10 institutions · 67 of 81 vouchered records shown · 14 without an institution code

09Environmental DNA22 detections

Where the DNA of Argyrotaenia provana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 15.0–18.2

Seasonal swing summer↔winter14.2 °C

Max temp (day)21.8 °C 19.6–22.5

Min temp (night)13.2 °C 11.8–14.6

Precipitation58.4 mm/mo 29.0–96.8

Air humidity59.4 % 59.0–64.3

Moisture balance-85.2 mm/mo -91.6–-21.6

Vapour deficit799 Pa 609–858

Wind speed2.60 m/s 1.90–4.00

Cloud cover32.4 % 31.0–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)