Argyrotaenia mariana

(Fernald, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records1 940

Data sources8

Biological traits0

DNA specimens122

eDNA detections127

Sources8 archives

Databases and archives Argyrotaenia mariana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 940 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI127 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics122 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 940 records

Environmental DNA1 datasets · 2 countries127 detections

DNA & barcodingBOLD122 specimens

01Narrative

Argyrotaenia mariana, the gray-banded leafroller moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Connecticut, Florida, Georgia, Illinois, Indiana, Kentucky, Maine, Maryland, Massachusetts, New Brunswick, New Hampshire, New York, North Carolina, Ohio, Ontario, Pennsylvania, Quebec, Tennessee and West Virginia.mothphotographersgroup The wingspan is about 20 mm. The ground colour of the forewings is pale yellowish or whitish with a large dark grey patch and a greenish-yellow band.Bug Guide Adults have been recorded on wing from March to August. The larvae feed on Acer species, Prenanthes species (including Prenanthes trifoliata) Alnus species, Betula species (including Betula alleghaniensis, Betula papyrifera, Betula populifolia), Viburnum species, Kalmia angustifolia, Vaccinium species (including Vaccinium uliginosum), Quercus species, Malus species (including Malus pumila, Malus sylvestris), Prunus virginiana, Pyrus species, Populus tremuloides, Salix species and Ulmus americana.Brown, J. W., G. Robinson & J. A. Powell. 2008. Food plant database of the leafrollers of the world (Lepidoptera: Tortricidae) (Version 1.0)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding122 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia mariana has left across the world's sequence archives.

At a glance

DNA specimens122

BINs1

Marker genes1

eDNA detections127

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus120 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

106Tvariable

118Cmostly conserved

160Amostly conserved

250Tmostly conserved

485Cmostly conserved

562Gmostly conserved

646Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGACTGTTAATTCGTGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes17

BIN1

Most divergent pair13.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia ljungianasame genus5.0%Argyrotaenia occultanasame genus5.0%Argyrotaenia tabulanasame genus5.3%Argyrotaenia hodgesisame genus5.5%Argyrotaenia floridanasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 940 records

Wild obs. + sensor1 539

Museum / vouchered401

Range

Area of Occupancy AOO3 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 912≤1 km 204≤10 km 59>10 km 94

1 269 georeferenced · 270 without coordinates

Open the mapobservation + sensor1 539

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 9≤1 km 56≤10 km 86>10 km 1

152 georeferenced · 249 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	108
New Haven, US	66
University of Guelph, Centre for Biodiversity Genomicslocation not on record	36
St. Paul, US	32
East Lansing, US	32
University of Alberta Museums (UAM)location not on record	25
ASUlocation not on record	8
Royal Saskatchewan Museumlocation not on record	6
Philadelphia, US	5
Biodiversity Institute of Ontariolocation not on record	3
Mississippi State, US	3
SOVTlocation not on record	3
Cambridge, US	2
Natural History Museum of Utahlocation not on record	1
Toronto, CA	1
Centre for Biodiversity Genomicslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Washington, US	1

18 institutions · 334 of 401 vouchered records shown · 67 without an institution code

09Environmental DNA127 detections

Where the DNA of Argyrotaenia mariana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found127

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 127 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial|14.5 Urban AreasForest1. Forest & WoodlandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 6.80–19.4

Seasonal swing summer↔winter27.3 °C

Max temp (day)18.6 °C 12.2–23.9

Min temp (night)8.10 °C 1.80–15.5

Precipitation91.3 mm/mo 71.7–121

Air humidity58.3 % 55.2–62.1

Moisture balance-35.6 mm/mo -56.4–43.3

Vapour deficit667 Pa 448–921

Wind speed3.10 m/s 2.50–4.00

Cloud cover47.4 % 39.0–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 121 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyrotaenia mariana

At a glance

Sources8 archives

At a glance

Record type1 940 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 940 records