Argyrotaenia ivana

(Fernald, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records53

Data sources7

Biological traits0

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Argyrotaenia ivana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF53 records

DNA & barcodingBOLD3 specimens

01Narrative

Argyrotaenia ivana, the Ivana leafroller moth, is a species of moth of the family Tortricidae. It is found in the United States, where it has been recorded from Alabama, Florida, Georgia, Louisiana, Maryland, Mississippi and Texas.mothphotographersgroupBug Guide The wingspan is about 12–16 mm. Adults have been recorded on wing nearly year round. The larvae feed on Acnida species, Amaranthus hybridus, Amaranthus spinosus, Apium species (including Apium graveolens), Galinsoga ciliata, Iva species (including Iva imbricata), Brassica oleracea, Commelina diffusa, Ipomoea batatas, Momordica charantia, Cyperus species, Medicago sativa, Vigna sinensis, Paspalum urvillei and Rosa odorata.Brown, J. W., G. Robinson & J. A. Powell. 2008. Food plant database of the leafrollers of the world (Lepidoptera: Tortricidae) (Version 1.0)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia ivana has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

22Avariable

TACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia amatanasame genus5.0%Clepsis abscisanasame family6.3%Homona aurigasame family6.5%Archips crataeganasame family6.7%Aphelia albocilianasame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor39

Museum / vouchered14

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 21≤1 km 5≤10 km 1>10 km 4

31 georeferenced · 8 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	11
St. Paul, US	3

2 institutions · 14 of 14 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)