Argyrotaenia amatana

(Dyar, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records74

Data sources8

Biological traits0

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Argyrotaenia amatana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Argyrotaenia amatana, the pondapple leafroller moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Florida and The Bahamas. The wingspan is 13–16 mm. Adults have been recorded nearly year round.mothphotographersgroup The larvae feed on a wide range of plants, including Acer rubrum, Eupatorium incarnatum, Laguncularia racemosa, Lysimola bahamensis, Persea borbonica, Persea americana, Sagittaria falcata, Salix caroliniana, Taxodium distichum, Annona glabra, Eugenia species and Nectandra coriacea.Host plants, Flight period and distribution of a precinctive Florida moth Argyrotaenia amatana (Lepidoptera, Tortricidae)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia amatana has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 5 variable positions, in barcode order

85Gvariable

106Tvariable

382Gvariable

500Tvariable

625Gvariable

TACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACATCTCTAAGATTATTAATTCGTGCTGAATTAGGAAATCCGGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia ivanasame genus5.0%Clepsis persicanasame family6.7%Epiphyas euraphodessame family6.8%Olethreutes costimaculanasame family6.8%Sparganothis distinctasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type74 records

Wild obs. + sensor32

Museum / vouchered42

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 16≤1 km 3≤10 km 2>10 km 7

28 georeferenced · 4 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	39
Cornell University Insect Collectionlocation not on record	3

2 institutions · 42 of 42 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Argyrotaenia amatana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.4–25.4

Seasonal swing summer↔winter5.30 °C

Max temp (day)27.5 °C 26.6–28.3

Min temp (night)21.4 °C 18.6–24.2

Precipitation104 mm/mo 84.8–122

Air humidity61.4 % 60.9–61.9

Moisture balance-70.0 mm/mo -120–-20.4

Vapour deficit1,183 Pa 1,099–1,266

Wind speed3.60 m/s 2.60–4.60

Cloud cover27.4 % 26.1–28.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)