Argyrostrotis sylvarum

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Argyrostrotis

At a glance

Occurrence records204

Data sources7

Biological traits0

DNA specimens14

eDNA detections15

Sources7 archives

Databases and archives Argyrostrotis sylvarum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF204 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD14 specimens

01Narrative

Argyrostrotis sylvarum, the woodland chocolate moth or brown wavy line argyrostrotis, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found in the US from Virginia south to Florida and Texas. The wingspan is about 28 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrostrotis sylvarum has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

88Amostly conserved

508Cmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrostrotis erasasame genus3.5%Argyrostrotis deletasame genus4.7%Gondysia similissame family4.9%Grammodes pulcherrimasame family5.6%Achaea catocaloidessame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type204 records

Wild obs. + sensor102

Museum / vouchered102

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 31≤1 km 18≤10 km 6>10 km 7

62 georeferenced · 40 without coordinates

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 7≤10 km 21>10 km 3

31 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	34
North Carolina State University Insect Museumlocation not on record	29
New Haven, US	12
Colorado State Universitylocation not on record	5
CUlocation not on record	4
Cornell University Insect Collectionlocation not on record	2
Georgia Museum of Natural Historylocation not on record	2
East Lansing, US	2
St. Paul, US	1

9 institutions · 91 of 102 vouchered records shown · 11 without an institution code

09Environmental DNA15 detections

Where the DNA of Argyrostrotis sylvarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 20.1–27.6

Seasonal swing summer↔winter16.1 °C

Max temp (day)29.9 °C 25.8–30.0

Min temp (night)18.4 °C 16.2–25.7

Precipitation113 mm/mo 80.8–193

Air humidity59.7 % 57.9–64.1

Moisture balance-34.0 mm/mo -74.3–15.1

Vapour deficit1,214 Pa 984–1,316

Wind speed2.70 m/s 2.10–3.30

Cloud cover33.6 % 27.7–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)