Argyroploce lediana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyroploce

At a glance

Occurrence records614

Data sources8

Biological traits0

DNA specimens34

eDNA detections35

Sources8 archives

Databases and archives Argyroploce lediana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility614 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF614 records

Environmental DNA3 datasets · 9 countries35 detections

DNA & barcodingBOLD34 specimens

01Narrative

Argyroploce lediana is a moth of the family Tortricidae. It was described by Carl Linnaeus in 1758. It is found in Scandinavia, northern Russia, the Baltic region, Germany, Poland, the Czech Republic, Slovakia, Austria and Romania.Fauna Europaea In the east, the range extends to Japan. The wingspan is 12–16 mm. Adults are on wing from June to July. The larvae feed on Ledum palustre.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyroploce lediana has left across the world's sequence archives.

At a glance

DNA specimens34

BINs3

Marker genes1

eDNA detections35

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

45Tmostly conserved

132Tmostly conserved

180Tmostly conserved

216Amostly conserved

222Tmostly conserved

237Avariable

258Tmostly conserved

270Amostly conserved

276Cmostly conserved

297Amostly conserved

301Gmostly conserved

311Gvariable

363Tmostly conserved

366Cmostly conserved

369Tmostly conserved

372Tmostly conserved

375Amostly conserved

387Tmostly conserved

390Tmostly conserved

396Cmostly conserved

399Tmostly conserved

405Cmostly conserved

417Tmostly conserved

435Amostly conserved

462Tmostly conserved

468Tmostly conserved

483Amostly conserved

486Amostly conserved

489Tmostly conserved

507Amostly conserved

535Tmostly conserved

537Amostly conserved

540Cmostly conserved

546Cmostly conserved

547Cmostly conserved

561Avariable

564Tmostly conserved

573Tmostly conserved

576Amostly conserved

595Amostly conserved

597Tmostly conserved

618Tmostly conserved

627Amostly conserved

633Tmostly conserved

636Tmostly conserved

639Tmostly conserved

645Cmostly conserved

ACATTATATTTTATTTTTGGTGTTTGAGCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes4

BINs3

Most divergent pair0.91%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyroploce externasame genus4.4%Selenodes concretanasame family5.1%Argyroploce aquilonanasame genus5.2%Olethreutes auricapitanasame family5.5%Olethreutes costimaculanasame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type614 records

Wild obs. + sensor451

Museum / vouchered163

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 66≤1 km 245≤10 km 132>10 km 5

448 georeferenced · 3 without coordinates

Open the mapobservation + sensor451

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 15≤1 km 61≤10 km 33>10 km 4

113 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	43
Tromsø, NO	20
Rovaniemi, FI	16
NHMOlocation not on record	15
SLU Artdatabankenlocation not on record	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Philadelphia, US	4
Kuopio, FI	3
Stockholm, SE	3
Helsinki, FI	3
NTNU-VMlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
ZMAAlocation not on record	1

16 institutions · 130 of 163 vouchered records shown · 33 without an institution code

09Environmental DNA35 detections

Where the DNA of Argyroploce lediana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys3

Countries9

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map9 countries0

4. Native Grassland|4.2 Subarctic Grasslandsubalpine1. Forest & Woodland|1.2 Subarctic ForestMixed habitatWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 11.0–15.3

Seasonal swing summer↔winter26.8 °C

Max temp (day)17.0 °C 13.8–19.9

Min temp (night)8.10 °C 5.30–12.3

Precipitation80.2 mm/mo 56.9–114

Air humidity58.0 % 55.1–62.0

Moisture balance-25.3 mm/mo -52.4–20.6

Vapour deficit649 Pa 518–706

Wind speed2.50 m/s 2.00–3.50

Cloud cover46.3 % 35.4–58.8

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)