Argyroploce externa

(Eversmann, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyroploce

At a glance

Occurrence records216

Data sources8

Biological traits0

DNA specimens19

eDNA detections19

Sources8 archives

Databases and archives Argyroploce externa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility216 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF216 records

Environmental DNA1 datasets · 4 countries19 detections

DNA & barcodingBOLD19 specimens

01Narrative

Argyroploce externa is a species of moth, belonging to the genus Argyroploce. It is native to Europe and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyroploce externa has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections19

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

29Gmostly conserved

94Gmostly conserved

421Gvariable

571Cmostly conserved

586Cvariable

613Tmostly conserved

619Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes5

BINs2

Most divergent pair2.1%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyroploce ledianasame genus4.4%Metendothenia atropunctanasame family5.8%Olethreutes costimaculanasame family5.9%Hedya separatanasame family6.1%Argyroploce aquilonanasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type216 records

Wild obs. + sensor161

Museum / vouchered55

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 13≤1 km 21≤10 km 118>10 km 1

153 georeferenced · 8 without coordinates

Open the mapobservation + sensor161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 12≤1 km 11≤10 km 9

32 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	16
NHMOlocation not on record	9
Philadelphia, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
SLU Artdatabankenlocation not on record	4
Tartu, EE	3
NTNU-VMlocation not on record	1

7 institutions · 43 of 55 vouchered records shown · 12 without an institution code

09Environmental DNA19 detections

Where the DNA of Argyroploce externa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map4 countries0

Forest1. Forest & Woodland|1.2 Subarctic Forest3. Shrubland | 3.1. Subarctic Shrubland1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland | 1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 9.90–16.4

Seasonal swing summer↔winter32.0 °C

Max temp (day)17.1 °C 13.9–21.7

Min temp (night)7.20 °C 4.90–12.2

Precipitation71.4 mm/mo 42.5–128

Air humidity56.7 % 53.3–62.2

Moisture balance-25.3 mm/mo -78.2–17.6

Vapour deficit639 Pa 461–848

Wind speed2.40 m/s 2.00–4.60

Cloud cover42.1 % 36.5–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)