Argyrogramma verruca

Fabricius, 1794 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Argyrogramma

At a glance

Occurrence records925

Data sources7

Biological traits0

DNA specimens14

eDNA detections1

Sources7 archives

Databases and archives Argyrogramma verruca's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility925 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF925 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD14 specimens

01Narrative

Argyrogramma verruca (golden looper) is a moth of the family Noctuidae. It is found from Maine to Florida to Texas, Kentucky, Arizona, Kansas, Southern Michigan, Pennsylvania, Ohio, Southern Ontario, the Antilles, Central America to Brazil to Northern Argentina and Paraguay. The wingspan is about 28 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrogramma verruca has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

79Tmostly conserved

85Cvariable

100Tmostly conserved

197Tmostly conserved

297Gmostly conserved

300Gmostly conserved

301Amostly conserved

302Amostly conserved

303Tmostly conserved

305Gmostly conserved

306Tmostly conserved

308Gmostly conserved

310Amostly conserved

311Amostly conserved

313Tmostly conserved

314Gmostly conserved

315Gmostly conserved

316Amostly conserved

318Cmostly conserved

320Gmostly conserved

322Amostly conserved

324Cmostly conserved

325Tmostly conserved

326Gmostly conserved

327Gmostly conserved

329Tmostly conserved

330Gmostly conserved

331Amostly conserved

332Amostly conserved

333Cmostly conserved

334Amostly conserved

335Gmostly conserved

336Tmostly conserved

337Tmostly conserved

338Tmostly conserved

339Amostly conserved

340Tmostly conserved

342Cmostly conserved

343Cmostly conserved

344Cmostly conserved

346Cmostly conserved

397Cmostly conserved

412Tmostly conserved

421Cmostly conserved

433Amostly conserved

628Gmostly conserved

646Cmostly conserved

TACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACATCCCTAAGATTACTAATTCGAGCAGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes3

BIN1

Most divergent pair1.1%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrogramma signatasame genus3.6%Thysanoplusia orichalceasame family4.6%Ctenoplusia agnatasame family5.0%Ctenoplusia furciferasame family5.3%Thysanoplusia chalcedonasame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type925 records

Wild obs. + sensor725

Museum / vouchered200

Range

Area of Occupancy AOO2 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 375≤1 km 95≤10 km 64>10 km 69

603 georeferenced · 122 without coordinates

Open the mapobservation + sensor725

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 5≤1 km 9≤10 km 50>10 km 8

72 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	89
Mississippi State, US	27
New Haven, US	20
East Lansing, US	17
St. Paul, US	7
CUlocation not on record	6
The University of the West Indies, Trinidad and Tobagolocation not on record	5
Georgia Museum of Natural Historylocation not on record	5
PUC-RSlocation not on record	3
Ciudad de México, MX	2
Colorado State Universitylocation not on record	2
San Diego, US	1
University of Pennsylvanialocation not on record	1
Research Collection of Matthew J. W. Cocklocation not on record	1
RMNHlocation not on record	1
UMUlocation not on record	1

16 institutions · 188 of 200 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Argyrogramma verruca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter1.50 °C

Max temp (day)27.7 °C

Min temp (night)24.2 °C

Precipitation131 mm/mo

Air humidity65.1 %

Vapour deficit1,150 Pa

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)