Argyrogramma signata

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Argyrogramma

At a glance

Occurrence records61

Data sources7

Biological traits0

DNA specimens23

eDNA detections22

Sources7 archives

Databases and archives Argyrogramma signata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 7 countries22 detections

DNA & barcodingBOLD23 specimens

01Narrative

Argyrogramma signata, the green semilooper, is a moth of the family Noctuidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrogramma signata has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections22

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

200Avariable

646Tvariable

TACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACATCATTAAGATTACTAATTCGAGCAGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes4

BIN1

Most divergent pair0.46%

OceaniaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrogramma verrucasame genus3.6%Ctenoplusia triteiasame family4.4%Ctenoplusia melanocephalasame family4.4%Thysanoplusia orichalceasame family4.4%Ctenoplusia furciferasame family4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor27

Museum / vouchered34

Origin

Native6

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 8≤1 km 4≤10 km 1>10 km 3

16 georeferenced · 11 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	8
SUVlocation not on record	6
Philadelphia, US	5
FACTlocation not on record	2
Taiwan Forestry Research Institutelocation not on record	2
Auckland, NZ	2
Natick, US	1
tesrilocation not on record	1
Research Collection of Graeme V. Cockslocation not on record	1

9 institutions · 28 of 34 vouchered records shown · 6 without an institution code

09Environmental DNA22 detections

Where the DNA of Argyrogramma signata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map7 countries0

Urban2. Savanna | 2.1. Dry Savanna

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 17.1–27.4

Seasonal swing summer↔winter7.90 °C

Max temp (day)25.9 °C 19.9–29.2

Min temp (night)20.4 °C 14.0–24.3

Precipitation62.9 mm/mo 36.3–284

Air humidity59.9 % 56.9–68.4

Moisture balance-39.4 mm/mo -74.4–123

Vapour deficit1,123 Pa 631–1,384

Wind speed2.80 m/s 1.80–3.70

Cloud cover32.7 % 18.7–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)