Argyrodes argyrodes

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theridiidae/Argyrodes

At a glance

Occurrence records711

Data sources9

Biological traits8

DNA specimens39

eDNA detections34

Sources9 archives

Databases and archives Argyrodes argyrodes's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility711 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

World Spider Trait DBMasaryk University8 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF711 records

Environmental DNA1 datasets · 0 countries34 detections

DNA & barcodingBOLD39 specimens

01Narrative

Die Diebsspinne (Argyrodes argyrodes) ist eine Webspinne aus der Familie der Kugelspinnen (Theridiidae). Die Art erhält wie die übergeordnete Gattung ihre deutsche Trivialbezeichnung durch ihre Ernährungsweise. Sie bedient sich an den Beutetieren von Echten Radnetzspinnen (Araneidae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMichalik & Ramirez 2014Pekár 2014aYrjola et al. 2024

Morphometry6

Body length2.25 mm

Cephalothorax height0.875 mm

Cephalothorax length1.25 mm

Cephalothorax width0.575 mm

Fang length0.212 mm

Tibia I length1.65 mm

Anatomy1

Sperm transfer formcleistospermia

Defence1

Primary defenceCrypsis

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrodes argyrodes has left across the world's sequence archives.

At a glance

DNA specimens39

BINs3

Marker genes2

eDNA detections34

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P685 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes2

BINs3

Most divergent pair0.73%

Where individuals differ — all 33 variable positions, in barcode order

36Amostly conserved

42Amostly conserved

54Amostly conserved

84Cmostly conserved

120Tmostly conserved

126Gmostly conserved

144Cmostly conserved

162Gmostly conserved

195Gmostly conserved

225Amostly conserved

245Tmostly conserved

264Tmostly conserved

276Gmostly conserved

294Gmostly conserved

297Gmostly conserved

354Tmostly conserved

378Gmostly conserved

402Cmostly conserved

471Tmostly conserved

480Gmostly conserved

483Cmostly conserved

514Tmostly conserved

516Amostly conserved

528Amostly conserved

534Gmostly conserved

552Amostly conserved

553Tmostly conserved

585Cmostly conserved

592Cmostly conserved

594Amostly conserved

600Amostly conserved

633Amostly conserved

639Gmostly conserved

CATAAAGATATTGGGACATTATATTTATTATTTGGAGCTTGATCAGCTATAGTAGGAACTGCAATAAGAGTAATAATTCGAATCGAATTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrodes elevatussame genus6.1%Argyrodes antipodianussame genus8.5%Argyrodes samoensissame genus8.7%Argyrodes argentatussame genus8.8%Rhomphaea rostratasame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type711 records

Wild obs. + sensor677

Museum / vouchered34

Range

Area of Occupancy AOO1 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 300≤1 km 72≤10 km 79>10 km 30

481 georeferenced · 196 without coordinates

Open the mapobservation + sensor677

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 4≤1 km 1≤10 km 1

6 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	7
	2
Frankfurt am Main	2
Royal Museum for Central Africalocation not on record	1
Barcelona, ES	1
Helsinki, FI	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

8 institutions · 16 of 34 vouchered records shown · 18 without an institution code

09Environmental DNA34 detections

Where the DNA of Argyrodes argyrodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)