Argyrodes antipodianus

O.Pickard-Cambridge, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theridiidae/Argyrodes

At a glance

Occurrence records574

Data sources9

Biological traits1

DNA specimens23

eDNA detections1

Sources9 archives

Databases and archives Argyrodes antipodianus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility574 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF574 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD23 specimens

01Narrative

Argyrodes antipodianus, also known as the dew drop spider, is a species of kleptoparasitic spider from the cobweb spider family found in Australia, New Zealand and New Caledonia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014a

Defence1

Primary defenceCamouflage

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrodes antipodianus has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 62 variable positions, in barcode order

1Gvariable

2Amostly conserved

3Cmostly conserved

4Amostly conserved

9Amostly conserved

10Tmostly conserved

13Amostly conserved

14Tmostly conserved

15Tmostly conserved

16Gmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

23Gmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

33Cmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

42Gmostly conserved

43Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Gmostly conserved

48Cmostly conserved

49Tmostly conserved

50Amostly conserved

54Gmostly conserved

56Gmostly conserved

58Amostly conserved

59Amostly conserved

60Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

70Tmostly conserved

72Amostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Cmostly conserved

81Amostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

89Amostly conserved

90Gmostly conserved

133Cmostly conserved

346Tmostly conserved

349Avariable

517Gvariable

GACATTATATTTATTGTTTGGAGCTTGATCTGCTATAGTAGGAACTGCTATAAGAGTAATAATTCGAATTGAACTAGGACAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes6

BINs2

Most divergent pair2.9%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrodes nephilaesame genus2.3%Argyrodes bonadeasame genus2.9%Argyrodes samoensissame genus5.3%Argyrodes argentatussame genus7.6%Argyrodes argyrodessame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type574 records

Wild obs. + sensor304

Museum / vouchered270

Range

Area of Occupancy AOO1 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 103≤1 km 45≤10 km 29>10 km 24

201 georeferenced · 103 without coordinates

Open the mapobservation + sensor304

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 6≤1 km 16≤10 km 17

39 georeferenced · 231 without coordinates

Open the institutions mapphysical evidence270

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	158
Sydney, AU	59
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	42
Western Australian Museumlocation not on record	4
QVMAGlocation not on record	3
Cambridge, US	1
Auckland, NZ	1
Frankfurt am Main	1
Tasmanian Museum & Art Gallerylocation not on record	1

9 institutions · 270 of 270 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Argyrodes antipodianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)