Argyresthia semifusca

Haworth, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records1 809

Data sources7

Biological traits2

DNA specimens23

eDNA detections35

Sources7 archives

Databases and archives Argyresthia semifusca's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 809 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 809 records

Environmental DNA3 datasets · 3 countries35 detections

DNA & barcodingBOLD23 specimens

01Narrative

Argyresthia semifusca is a moth of the family Yponomeutidae. It is found in Europe.Fauna Europaea The wingspan is about 12 mm. The head is white. Forewings are dark purplish-bronzy-fuscous; a thick white dorsal streak to tornus, interrupted by a median spot of ground-colour ; costa marked with minute white dashes, posteriorly with three or four white strigulae. Hindwings are grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on the wing from June to September depending on the location. The larvae feed on Crataegus and Sorbus aucuparia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia semifusca has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes2

eDNA detections35

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

1Tmostly conserved

19Tmostly conserved

34Amostly conserved

58Amostly conserved

91Amostly conserved

100Tmostly conserved

238Amostly conserved

343Avariable

368Amostly conserved

370Amostly conserved

379Tmostly conserved

427Tmostly conserved

442Cmostly conserved

451Tmostly conserved

460Cmostly conserved

562Gvariable

TACATTATATTTTATATTTGGAATTTGATCTGGAATAGTAGGAACATCACTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes9

BINs2

Most divergent pair2.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia semitestacellasame genus1.8%Argyresthia pygmaeellasame genus4.6%Argyresthia curvellasame genus5.3%Argyresthia submontanasame genus5.5%Argyresthia sorbiellasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 809 records

Wild obs. + sensor1 478

Museum / vouchered288

Other43

Range

Area of Occupancy AOO3 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 575≤1 km 287≤10 km 590

1 452 georeferenced · 26 without coordinates

Open the mapobservation + sensor1 478

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 59≤1 km 115≤10 km 33>10 km 22

229 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	74
NHMOlocation not on record	58
Kuopio, FI	29
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	17
DanishLepidopterologicalSocietylocation not on record	17
Provincia di Livornolocation not on record	14
Tartu, EE	12
SLU Artdatabankenlocation not on record	12
Stockholm, SE	6
Salzburg, AT	4
NTNU-VMlocation not on record	2
Trondheim, NO	2
NCMGlocation not on record	2
Research Collection of Kai Berggrenlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Metsähallituslocation not on record	1
Helsinki, FI	1
RMZlocation not on record	1
Rovaniemi, FI	1
neflocation not on record	1
ZMAAlocation not on record	1
University of Oululocation not on record	1

22 institutions · 259 of 288 vouchered records shown · 29 without an institution code

09Environmental DNA35 detections

Where the DNA of Argyresthia semifusca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys3

Countries3

Verifiable raw sequence linked17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map3 countries0

Forest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 8.70–16.2

Seasonal swing summer↔winter20.3 °C

Max temp (day)16.1 °C 11.2–20.7

Min temp (night)9.70 °C 3.60–13.3

Precipitation95.6 mm/mo 62.9–138

Air humidity61.1 % 59.0–63.1

Moisture balance19.4 mm/mo -25.7–60.5

Vapour deficit579 Pa 434–753

Wind speed2.50 m/s 2.00–5.20

Cloud cover47.6 % 45.6–55.4

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia semifusca

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 809 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 809 records