Argyresthia glabratella

Zeller, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records1 371

Data sources9

Biological traits2

DNA specimens86

eDNA detections155

Sources9 archives

Databases and archives Argyresthia glabratella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 371 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI155 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics86 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 371 records

Environmental DNA4 datasets · 8 countries155 detections

DNA & barcodingBOLD86 specimens

Genome at a glanceGoaT · NCBI≈909 Mbp

01Narrative

Argyresthia glabratella, the spruce argent, is a moth of the family Yponomeutidae. It is found in most Europe, except Ireland, the Iberian Peninsula, Hungary, Slovenia, Croatia and Greece.Fauna Europaea The wingspan is 8–11 mm.microlepidoptera.nl It is very similar to Argyresthia laevigatella.Certain identification requires dissection of the genitalia.Adults are on wing in May and June. The larvae feed on Picea abies. They mine the shoots of their host plant.UKmoths

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding86 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia glabratella has left across the world's sequence archives.

At a glance

DNA specimens86

BINs1

Marker genes1

eDNA detections155

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

181Gmostly conserved

265Amostly conserved

271Cmostly conserved

319Amostly conserved

364Tmostly conserved

427Cmostly conserved

529Tmostly conserved

592Gmostly conserved

616Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes21

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia columbiasame genus6.2%Argyresthia amiantellasame genus6.2%Argyresthia abiessame genus6.7%Argyresthia piceasame genus6.8%Argyresthia aurulentellasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Argyresthia glabratella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈909 012 005 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argyresthia glabratella0.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 371 records

Wild obs. + sensor1 025

Museum / vouchered342

Other4

Range

Area of Occupancy AOO2 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 397≤1 km 210≤10 km 384>10 km 2

993 georeferenced · 32 without coordinates

Open the mapobservation + sensor1 025

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 92≤1 km 73≤10 km 81>10 km 18

264 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence342

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	86
Oulu, FI	74
Tartu, EE	22
DanishLepidopterologicalSocietylocation not on record	19
Rovaniemi, FI	18
Kuopio, FI	17
SLU Artdatabankenlocation not on record	14
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	9
Stockholm, SE	6
ZSMlocation not on record	4
Salzburg, AT	3
Metsähallituslocation not on record	2
NTNU-VMlocation not on record	2
neflocation not on record	2
South Kensington, GB	2
DABUHlocation not on record	2
Provincia di Livornolocation not on record	1
Research Collection of Alfred Haslbergerlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
ZMAAlocation not on record	1

20 institutions · 286 of 342 vouchered records shown · 56 without an institution code

09Environmental DNA155 detections

Where the DNA of Argyresthia glabratella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found155

Studies independent surveys4

Countries8

Verifiable raw sequence linked58

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 155 detections have coordinates

Open the map8 countries0

Bog edge in alpine birch forestOlder mixed coniferous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 9.90–15.6

Seasonal swing summer↔winter19.8 °C

Max temp (day)16.5 °C 13.2–19.2

Min temp (night)8.20 °C 4.90–11.4

Precipitation103 mm/mo 62.0–212

Air humidity60.0 % 56.0–63.4

Moisture balance5.40 mm/mo -49.6–108

Vapour deficit625 Pa 447–705

Wind speed2.70 m/s 1.80–4.90

Cloud cover42.1 % 35.1–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 152 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia glabratella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 371 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 371 records