Argia tarascana

Calvert, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records426

Data sources8

Biological traits0

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Argia tarascana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility426 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF426 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Argia tarascana, the Tarascan dancer, is a species of narrow-winged damselfly in the family Coenagrionidae. It is found in Central America and North America. The IUCN conservation status of Argia tarascana is "LC", least concern, with no immediate threat to the species' survival. The population is stable.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia tarascana has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P463 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.9%

Haplotypes2

BIN1

Most divergent pair2.6%

Where individuals differ — all 12 variable positions, in barcode order

22Avariable

46Cvariable

83Cvariable

92Tvariable

121Gvariable

187Avariable

211Tvariable

246Avariable

256Avariable

347Cvariable

424Avariable

439Tvariable

ACTAGTACCTTTAATATTAGGAGCACCAGATATAGCTTTCCCACGCCTTAATAATATAAGATTTTGATTACTCCCTCCTTCACTAACCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argia fumipennissame genus10.6%Peristicta aeneoviridissame family11.9%Argia pocomanasame genus12.1%Argia hineisame genus12.6%Ophiogomphus mainensissame order14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type426 records

Wild obs. + sensor253

Museum / vouchered173

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 23≤1 km 19≤10 km 2>10 km 120

164 georeferenced · 89 without coordinates

Open the mapobservation + sensor253

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 64≤1 km 15≤10 km 1>10 km 3

83 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	60
Durango, MX	54
Washington, US	17
Ciudad de México, MX	4
Cambridge, US	1
University Park, US	1
Essig Museum of Entomologylocation not on record	1
Juriquilla, MX	1

8 institutions · 139 of 173 vouchered records shown · 34 without an institution code

09Environmental DNA3 detections

Where the DNA of Argia tarascana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 20.1–29.9

Seasonal swing summer↔winter8.20 °C

Max temp (day)31.8 °C 25.8–37.8

Min temp (night)17.5 °C 13.5–21.4

Precipitation27.6 mm/mo 6.50–48.7

Air humidity50.7 % 45.4–56.0

Moisture balance-137 mm/mo -170–-105

Vapour deficit1,725 Pa 1,086–2,364

Wind speed3.10 m/s 2.40–3.90

Cloud cover23.0 % 21.9–24.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)