Argia oenea

Hagen, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records2 005

Data sources8

Biological traits0

DNA specimens10

eDNA detections5

Sources8 archives

Databases and archives Argia oenea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 005 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 005 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD10 specimens

01Narrative

Argia oenea, the fiery-eyed dancer, is a species of narrow-winged damselfly in the family Coenagrionidae. It is found in Central America and North America. The IUCN conservation status of Argia oenea is "LC", least concern, with no immediate threat to the species' survival. The population is stable.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia oenea has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections5

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P427 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)6.2%

Haplotypes1

BINs2

Where individuals differ — all 56 variable positions, in barcode order

34Amostly conserved

35Tmostly conserved

43Gmostly conserved

55Cmostly conserved

56Tmostly conserved

58Amostly conserved

61Gmostly conserved

91Cmostly conserved

94Gmostly conserved

97Tmostly conserved

103Gmostly conserved

109Gmostly conserved

118Tmostly conserved

124Tmostly conserved

127Amostly conserved

136Gmostly conserved

148Amostly conserved

166Tmostly conserved

175Tmostly conserved

181Gmostly conserved

199Cmostly conserved

202Gmostly conserved

211Cmostly conserved

244Amostly conserved

250Amostly conserved

262Cmostly conserved

265Amostly conserved

268Gmostly conserved

289Gmostly conserved

295Cmostly conserved

304Amostly conserved

307Amostly conserved

313Amostly conserved

314Tmostly conserved

316Gmostly conserved

319Gmostly conserved

322Cmostly conserved

334Cmostly conserved

337Amostly conserved

346Cmostly conserved

349Gmostly conserved

353Tmostly conserved

355Amostly conserved

367Tmostly conserved

370Tmostly conserved

376Gmostly conserved

385Tmostly conserved

386Cvariable

387Gvariable

388Tvariable

389Cvariable

391Ahighly variable

397Avariable

400Avariable

412Cvariable

424Cvariable

AGCTTTCCCACGACTTAATAACATGAGATTTTGATTACTCCCGCCTTCATTAACCTTATTGCTAGCAAGAAGATTAGTAGAAAGAGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argia oculatasame genus14.1%Argia rogersisame genus14.5%Pseudocopera ciliatasame order16.4%Argia extraneasame genus16.7%Argia tarascanasame genus16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 005 records

Wild obs. + sensor980

Museum / vouchered1 025

Range

Area of Occupancy AOO2 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 350≤1 km 171≤10 km 46>10 km 19

586 georeferenced · 394 without coordinates

Open the mapobservation + sensor980

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 669≤1 km 17≤10 km 44

730 georeferenced · 295 without coordinates

Open the institutions mapphysical evidence1 025

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	547
Washington, US	238
Durango, MX	58
University Park, US	39
Ciudad de México, MX	29
Centro Regional de Investigación en Salud Pública, Instituto Nacional de Salud Públicalocation not on record	16
Odonata Centrallocation not on record	12
National Biodiversity Institute, Costa Ricalocation not on record	10
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	6
Essig Museum of Entomologylocation not on record	3
New Haven, US	2
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	2
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Montréal, CA	1
Bavarian State Collection of Zoologylocation not on record	1

16 institutions · 966 of 1 025 vouchered records shown · 59 without an institution code

09Environmental DNA5 detections

Where the DNA of Argia oenea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Cobble

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.7 °C 21.4–29.7

Seasonal swing summer↔winter2.60 °C

Max temp (day)33.7 °C 27.4–33.7

Min temp (night)25.8 °C 14.6–25.8

Precipitation186 mm/mo 72.5–186

Air humidity55.6 % 47.6–55.6

Moisture balance-26.0 mm/mo -103–-26.0

Vapour deficit1,846 Pa 1,354–1,846

Wind speed3.70 m/s 3.70–4.30

Cloud cover28.0 % 27.1–28.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argia oenea

At a glance

Sources8 archives

At a glance

Record type2 005 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 005 records