Argia lugens

(Hagen, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records2 889

Data sources8

Biological traits0

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Argia lugens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 889 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 889 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Argia lugens, the sooty dancer, is a species of narrow-winged damselfly in the family Coenagrionidae. It is found in Central America and North America. The IUCN conservation status of Argia lugens is "LC", least concern, with no immediate threat to the species' survival. The population is stable. Sooty dancer, Argia lugens Sooty dancer, Argia lugens

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia lugens has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes1

BIN1

Where individuals differ — all 17 variable positions, in barcode order

58Avariable

154Cvariable

268Cvariable

316Gmostly conserved

337Cmostly conserved

346Cvariable

347Cvariable

355Avariable

364Cmostly conserved

391Avariable

445Tmostly conserved

472Avariable

556Amostly conserved

568Cvariable

625Amostly conserved

628Tmostly conserved

653Cvariable

AACTCTTTATCTAATATTTGGGGCATGGGCAGGAATAGTAGGAACTGCTCTTAGCATACTAATTCGGGTTGAATTAGGTCAGCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argia cupraureasame genus12.6%Argia translatasame genus13.9%Huosoma latilobasame family14.8%Argia hineisame genus14.8%Argia emmasame genus15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 889 records

Wild obs. + sensor2 174

Museum / vouchered715

Origin

Native20

Range

Area of Occupancy AOO4 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 836≤1 km 388≤10 km 80>10 km 144

1 448 georeferenced · 726 without coordinates

Open the mapobservation + sensor2 174

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 26≤1 km 52≤10 km 68>10 km 31

177 georeferenced · 538 without coordinates

Open the institutions mapphysical evidence715

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	217
Washington, US	124
San Francisco, US	69
CASlocation not on record	34
New Haven, US	31
Los Angeles, US	20
Essig Museum of Entomologylocation not on record	10
University Park, US	10
Provo, US	8
Champaign, US	7
Cornell University Insect Collectionlocation not on record	7
Wuzhou, CN	7
UCBMElocation not on record	6
East Lansing, US	6
Mexico City, MX	4
Lubbock, US	3
Awka, NG	2
Montréal, CA	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	1
Durango, MX	1
US	1
Juriquilla, MX	1
US	1

25 institutions · 575 of 715 vouchered records shown · 140 without an institution code

09Environmental DNA6 detections

Where the DNA of Argia lugens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 18.7–21.0

Seasonal swing summer↔winter9.60 °C

Max temp (day)25.9 °C 24.4–28.5

Min temp (night)13.2 °C 11.5–14.4

Precipitation22.1 mm/mo 8.60–86.5

Air humidity55.0 % 43.7–58.9

Moisture balance-130 mm/mo -153–-61.8

Vapour deficit1,118 Pa 907–1,287

Wind speed2.80 m/s 1.70–3.80

Cloud cover24.1 % 19.8–32.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argia lugens

At a glance

Sources8 archives

At a glance

Record type2 889 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 889 records