Arge captiva

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records108

Data sources6

Biological traits0

DNA specimens4

eDNA detections3

Sources6 archives

Databases and archives Arge captiva's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF108 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Arge captiva is a species from the genus Arge. This species was originally described by Franz von Paula Schrank in 1802

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge captiva has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)5.1%

Haplotypes1

BINs2

Where individuals differ — all 67 variable positions, in barcode order

212Cmostly conserved

217Amostly conserved

218Gmostly conserved

220Amostly conserved

235Tmostly conserved

241Tmostly conserved

242Cmostly conserved

244Tmostly conserved

263Tmostly conserved

265Amostly conserved

266Tmostly conserved

268Amostly conserved

271Cmostly conserved

277Amostly conserved

290Amostly conserved

294Tmostly conserved

295Amostly conserved

306Tmostly conserved

310Amostly conserved

319Amostly conserved

328Cmostly conserved

334Tmostly conserved

337Amostly conserved

340Tmostly conserved

349Amostly conserved

352Tmostly conserved

361Tmostly conserved

376Cmostly conserved

379Amostly conserved

382Amostly conserved

386Cmostly conserved

401Cmostly conserved

403Tmostly conserved

412Amostly conserved

415Gmostly conserved

427Tmostly conserved

428Tmostly conserved

436Amostly conserved

455Amostly conserved

456Cmostly conserved

460Tmostly conserved

472Cmostly conserved

478Cmostly conserved

494Tmostly conserved

496Amostly conserved

499Amostly conserved

506Gmostly conserved

517Amostly conserved

541Tmostly conserved

542Tmostly conserved

544Amostly conserved

547Amostly conserved

550Amostly conserved

553Tmostly conserved

562Tmostly conserved

571Cmostly conserved

595Cmostly conserved

604Amostly conserved

607Amostly conserved

616Tmostly conserved

619Tmostly conserved

625Tmostly conserved

628Amostly conserved

634Tmostly conserved

637Tmostly conserved

638Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATCTGATCAGGAATAATAGGACTTTCACTTAGAATAATTATTCGAACAGAATTAAGTTCTGTAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge metallicasame genus10.5%Arge melanochrasame genus11.2%Arge cingulatasame genus11.4%Arge berberidissame genus11.6%Arge rusticasame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type108 records

Wild obs. + sensor100

Museum / vouchered8

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 21≤1 km 13≤10 km 5>10 km 1

40 georeferenced · 60 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	2
KNAMlocation not on record	1
KCMNlocation not on record	1
ZMAAlocation not on record	1

4 institutions · 5 of 8 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Arge captiva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 19.4–19.4

Seasonal swing summer↔winter34.8 °C

Max temp (day)24.9 °C

Min temp (night)12.7 °C

Precipitation37.3 mm/mo

Air humidity50.1 %

Moisture balance-120 mm/mo

Vapour deficit1,132 Pa

Wind speed3.80 m/s

Cloud cover33.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)