Arenaeus mexicanus

(Gerstaecker, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Portunidae/Arenaeus

At a glance

Occurrence records327

Data sources7

Biological traits2

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Arenaeus mexicanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility277 records↗

OBISOcean Biodiversity Information System50 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS327 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Arenaeus mexicanus is een krabbensoort uit de familie van de Portunidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1856 door Gerstaecker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenaeus mexicanus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P681 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

6Tmostly conserved

117Amostly conserved

327Amostly conserved

345Gvariable

369Tmostly conserved

426Gvariable

570Cmostly conserved

597Cvariable

606Amostly conserved

GATATTGGTACCTTATATTTTATTTTCGGAGCATGATCTGGAATAGTAGGCACTTCTCTTAGTCTTATCATTCGAGCCGAATTAGGTCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes3

BIN1

Most divergent pair0.88%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arenaeus cribrariussame genus12.6%Portunus pelagicussame family14.5%Portunus reticulatussame family14.8%Charybdis truncatasame family15.7%Portunus armatussame family15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type327 records

Wild obs. + sensor150

Museum / vouchered177

Range

Area of Occupancy AOO800 km²

Depth

0–200 m sunlit34

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 13.7 m · max 82.3 m · 34 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 73≤1 km 27≤10 km 8>10 km 3

111 georeferenced · 39 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 106≤1 km 4≤10 km 26>10 km 1

137 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	36
Mexico City, MX	34
Washington, US	20
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	10
San Nicolás de los Garza, MX	9
Frankfurt am Main	3
Universidad del Valle (UniValle)location not on record	3
ICM-CSIClocation not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Laboratorio de Ecosistemas Marinos y Acuicultura, Centro Universitario de Ciencias Biológicas y Agropecuarias, Universidad de Guadalajaralocation not on record	1
Cambridge, US	1
	1

12 institutions · 120 of 177 vouchered records shown · 9 without an institution code

09Environmental DNA6 detections

Where the DNA of Arenaeus mexicanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 21.0–21.0

Seasonal swing summer↔winter1.70 °C

Max temp (day)26.5 °C

Min temp (night)17.0 °C

Precipitation58.1 mm/mo

Air humidity63.0 %

Moisture balance-91.6 mm/mo

Vapour deficit917 Pa

Wind speed2.00 m/s

Cloud cover14.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)