Arenaeus cribrarius

(Lamarck, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Portunidae/Arenaeus

At a glance

Occurrence records5 028

Data sources11

Biological traits6

DNA specimens48

eDNA detections49

Sources11 archives

Databases and archives Arenaeus cribrarius's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 682 records↗

OBISOcean Biodiversity Information System1 346 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS5 028 records

Environmental DNA1 datasets · 6 countries49 detections

DNA & barcodingBOLD48 specimens

01Narrative

Arenaeus cribrarius, the speckled swimming crab, is a species of swimming crab in the family Portunidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length14.1 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits2

Depth max68 m

Depth min0 m

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenaeus cribrarius has left across the world's sequence archives.

At a glance

DNA specimens48

BINs1

Marker genes1

eDNA detections49

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

26Amostly conserved

200Amostly conserved

206Tmostly conserved

227Amostly conserved

305Cmostly conserved

527Amostly conserved

647Tvariable

TTGGAGCATGATCTGGAATAGTAGGAACCTCTCTTAGTCTTATTATTCGAGCTGAATTAGGTCAACCTGGTACCCTTATTGGTAATGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes6

BIN1

Most divergent pair0.46%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arenaeus mexicanussame genus12.6%Portunus pelagicussame family13.7%Cavoportunus dubiussame family14.9%Scylla paramamosainsame family15.0%Callinectes bocourtisame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 028 records

Wild obs. + sensor4 361

Museum / vouchered611

Cultivated / captive8

Other48

Origin

Native4

Range

Area of Occupancy AOO7 736 km²

Depth

0–200 m sunlit1 178

200–1000 m twilight1

1–4 km midnight1

>4 km abyssal0

median 8 m · max 1 628 m · 1 180 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 860≤1 km 421≤10 km 278>10 km 192

2 751 georeferenced · 1 610 without coordinates

Open the mapobservation + sensor4 361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 76≤1 km 4≤10 km 20>10 km 24

124 georeferenced · 487 without coordinates

Open the institutions mapphysical evidence611

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
PUC-RSlocation not on record	135
Washington, US	79
Mexico City, MX	41
San Nicolás de los Garza, MX	38
Cambridge, US	17
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	16
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	15
CASlocation not on record	9
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	8
UM-RSMASlocation not on record	8
Texas Cooperative Wildlife Collectionlocation not on record	4
Masindi, UG	3
New Haven, US	2
Paris, FR	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
	2
Zoologisches Museum Hamburglocation not on record	1
Sistema de Colecciones Biológicas, Escuela de Biología, Universidad de San Carlos de Guatemala location not on record	1
Universidad de La Salle (La Salle)location not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
FCMMlocation not on record	1
Denver, US	1
Universidad del Valle (UniValle)location not on record	1
Porto Alegre, BR	1
UNICAMPlocation not on record	1

26 institutions · 391 of 611 vouchered records shown · 38 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA49 detections

Where the DNA of Arenaeus cribrarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 21.3–25.5

Seasonal swing summer↔winter6.00 °C

Max temp (day)25.0 °C 22.6–27.3

Min temp (night)21.2 °C 19.2–24.7

Precipitation124 mm/mo 36.2–233

Air humidity64.6 % 60.8–67.8

Vapour deficit974 Pa 876–1,275

Cloud cover29.9 % 14.0–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arenaeus cribrarius

At a glance

Sources11 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits2

At a glance

Record type5 028 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 028 records