Ardiosteres moretonella

(Walker, 1866) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Psychidae/Ardiosteres

At a glance

Occurrence records67

Data sources4

Biological traits0

DNA specimens9

eDNA detections7

Sources4 archives

Databases and archives Ardiosteres moretonella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Ardiosteres moretonella is een vlinder uit de familie van de zakjesdragers (Psychidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1866 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardiosteres moretonella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs4

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

16Tmostly conserved

37Amostly conserved

46Amostly conserved

70Cmostly conserved

85Amostly conserved

88Cmostly conserved

103Tmostly conserved

106Cmostly conserved

124Cmostly conserved

145Cmostly conserved

148Amostly conserved

157Tvariable

166Avariable

187Cmostly conserved

193Cmostly conserved

220Tmostly conserved

235Cmostly conserved

295Amostly conserved

310Gvariable

313Cvariable

347Cmostly conserved

355Cmostly conserved

373Amostly conserved

376Amostly conserved

400Tvariable

412Amostly conserved

436Tmostly conserved

466Amostly conserved

469Avariable

484Cvariable

499Cvariable

500Tmostly conserved

508Amostly conserved

514Cvariable

517Amostly conserved

523Cmostly conserved

533Cmostly conserved

562Amostly conserved

571Cmostly conserved

577Gmostly conserved

607Avariable

613Cmostly conserved

616Tvariable

622Gvariable

625Amostly conserved

628Amostly conserved

649Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGATTATTAGGAACATCAATAAGAATATTAATTCGAACCGAACTAGGAACTTCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes7

BINs4

Most divergent pair4.7%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris albicomanasame order14.1%Eutelia fulvigriseasame order14.1%Earias syriacanasame order14.7%Chrysocale ferenssame order14.9%Quentalia subumbratasame order14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor62

Museum / vouchered5

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 30≤1 km 20≤10 km 1>10 km 1

52 georeferenced · 10 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NSW Dept of Planning, Industry and Environmentlocation not on record	1

1 institutions · 1 of 5 vouchered records shown · 4 without an institution code

09Environmental DNA7 detections

Where the DNA of Ardiosteres moretonella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 20.0–24.5

Seasonal swing summer↔winter13.8 °C

Max temp (day)26.5 °C 24.2–30.2

Min temp (night)17.5 °C 15.7–19.0

Precipitation49.7 mm/mo 42.1–130

Air humidity54.8 % 49.1–62.6

Moisture balance-66.7 mm/mo -125–18.9

Vapour deficit1,052 Pa 878–1,570

Wind speed3.30 m/s 2.40–3.60

Cloud cover27.0 % 24.0–29.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)