Ardeola ralloides

(Scopoli, 1769) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Pelecaniformes/Ardeidae/Ardeola

At a glance

Occurrence records262 540

Data sources10

Biological traits32

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Ardeola ralloides's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 540 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Occurrence & distributionGBIF262 540 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

The squacco heron (Ardeola ralloides) is a small heron, 44 – long, of which the body is 20 –, with 80 – wingspan. It is of Old World origins, breeding in southern Europe and the Greater Middle East.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology14

Beak depth11.8 mm

Beak length (culmen)72.8 mm

Beak length (nares)51.5 mm

Beak width9.1 mm

Body mass290 g

Body mass (female)291 g

Body mass (male)285 g

Hand-wing index32.4

Kipp's distance68.2 mm

SVL46 cm

Secondary length143 mm

Tail length75.8 mm

Tarsus length59.4 mm

Wing length213 mm

Life cycle & reproduction7

Egg mass16 g

Fledging age35 days

Fledging mass238 g

Incubation23 days

Litter size4

Litters per year1 /year

Max. longevity70.0 months

Diet & foraging7

Fish60 %

Ground50 %

Invertebrate10 %

Trophic levelcarnivore

Trophic nicheAquatic predator

Vertebrate unknown30 %

Water around surface50 %

Habitat & environment4

HabitatWetland

Migration3.0

Primary lifestyleTerrestrial

Range size20 358 790 km²

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardeola ralloides has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTATATCTAATCTTTGGAGCATGAGCTGGCATAATTGGAACTGCCCTAAGCCTACTTATCCGAGCTGAACTTGGCCAACCCGGAACACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ardeola bacchussame genus5.0%Bubulcus ibissame family9.0%Agamia agamisame family10.1%Egretta sacrasame family10.3%Ardea herodiassame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type262 540 records

Wild obs. + sensor261 495

Museum / vouchered781

Cultivated / captive142

Other122

Origin

Native1 925

Range

Area of Occupancy AOO103 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 24 099≤1 km 9 073≤10 km 17 129>10 km 2 983

53 284 georeferenced · 208 211 without coordinates

Open the mapobservation + sensor261 495

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 154≤10 km 327>10 km 50

531 georeferenced · 250 without coordinates

Open the institutions mapphysical evidence781

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 142

142 georeferenced

Open the mapnot free-living142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	53
Washington, US	36
Brussels, BE	30
Copenhagen, DK	24
MRAClocation not on record	22
RBINS-Scientific Heritagelocation not on record	22
Cambridge, US	19
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	18
Geneva, CH	18
South Kensington, GB	14
Ann Arbor, US	11
NHMOlocation not on record	7
Sevilla, ES	7
Provincia di Livornolocation not on record	7
New Haven, US	6
Zografou, GR	6
Los Angeles, US	4
Philadelphia, US	4
SMNHTAUlocation not on record	4
Toronto, CA	4
Salzburg, AT	3
Instituto de Investigação Científica Tropicallocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Institute of Plant and Animal Ecology UB RASlocation not on record	3
Barcelona, ES	3
Louisiana State University, Museum of Zoologylocation not on record	2
IMEDEAlocation not on record	2
Universidad de Navarra, Museum of Zoologylocation not on record	2
BG-NMNHSlocation not on record	2
Bourges, FR	1
US	1
Ugentlocation not on record	1
Chongqing Museumlocation not on record	1
Albany, US	1
Iowa City, US	1
Zoologisches Museum Hamburglocation not on record	1
KU Leuvenlocation not on record	1
Seattle, US	1
Frankfurt am Main	1

39 institutions · 349 of 781 vouchered records shown · 432 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Ardeola ralloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median37.4 °C 23.8–37.4

Seasonal swing summer↔winter27.5 °C

Max temp (day)44.1 °C 25.8–44.1

Min temp (night)30.1 °C 21.5–30.1

Precipitation0 mm/mo 0–31.0

Air humidity33.1 % 33.1–56.4

Moisture balance-246 mm/mo -246–-149

Vapour deficit4,298 Pa 1,584–4,298

Wind speed3.80 m/s 3.80–4.40

Cloud cover8.40 % 8.40–27.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ardeola ralloides

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction7

Diet & foraging7

Habitat & environment4

At a glance

Record type262 540 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 39 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type262 540 records