Ardeola bacchus

(Bonaparte, 1855) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Pelecaniformes/Ardeidae/Ardeola

At a glance

Occurrence records149 412

Data sources11

Biological traits31

DNA specimens15

eDNA detections9

Sources11 archives

Databases and archives Ardeola bacchus's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 409 records↗

OBISOcean Biodiversity Information System3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources31 traits

Occurrence & distributionGBIF · OBIS149 412 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT2n = 68

01Narrative

The Chinese pond heron (Ardeola bacchus) is an East Asian freshwater bird of the heron family, (Ardeidae). Adult take-off in winter plumage It is one of six species of birds known as "pond herons" (genus Ardeola). It is parapatric (or nearly so) with the Indian pond heron (A. grayii) to the west and the Javan pond heron (A. speciosa) to the south, and these three are presumed to form a superspecies. As a group they are variously affiliated with the squacco heron (A. ralloides) or the Malagasy pond heron (A. idae). As of mid-2011 there are no published molecular analyses of pond heron interrelationships and osteological data is likewise not analyzed for all relevant comparison taxa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology14

Beak depth12.2 mm

Beak length (culmen)72.9 mm

Beak length (nares)52.4 mm

Beak width9.2 mm

Body mass306 g

Body mass (female)280 g

Body mass (male)332 g

Hand-wing index26.8

Kipp's distance56.6 mm

SVL45 cm

Secondary length153 mm

Tail length73.4 mm

Tarsus length56.2 mm

Wing length213 mm

Life cycle & reproduction5

Egg mass17 g

Fledging age30 days

Incubation20 days

Litter size4

Litters per year2 /year

Diet & foraging8

Fish10 %

Ground10 %

Invertebrate70 %

Trophic levelcarnivore

Trophic nicheAquatic predator

Vertebrate ectotherm20 %

Water around surface70 %

Water below surface20 %

Habitat & environment4

HabitatWetland

Migration2.0

Primary lifestyleTerrestrial

Range size5 458 763 km²

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardeola bacchus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes10

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.00%

Haplotypes2

BINs2

Most divergent pair3.0%

Where individuals differ — all 19 variable positions, in barcode order

1Gmostly conserved

24Tmostly conserved

129Gmostly conserved

168Tmostly conserved

177Tmostly conserved

189Tmostly conserved

297Cmostly conserved

321Tmostly conserved

345Cmostly conserved

420Cmostly conserved

442Cmostly conserved

453Cmostly conserved

522Cmostly conserved

525Cmostly conserved

527Cmostly conserved

528Amostly conserved

558Cmostly conserved

627Cmostly conserved

633Cmostly conserved

GTTGGAACTGCCCTAAGCCTACTTATTCGAGCTGAACTTGGCCAACCCGGAACACTGCTAGGAGACGACCAAATCTACAATGTAGTCGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ardeola ralloidessame genus5.0%Agamia agamisame family8.4%Bubulcus ibissame family9.1%Ixobrychus eurhythmussame family10.1%Gorsachius melanolophussame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_025921 ↗ · 14 protein · 25 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Ardeola bacchus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Chromosome records68–682n range68median68mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 682×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

08Occurrence & distribution

Record type149 412 records

Wild obs. + sensor149 322

Museum / vouchered70

Other20

Origin

Native5

Range

Area of Occupancy AOO64 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 3 188≤1 km 2 987≤10 km 1 761>10 km 434

8 370 georeferenced · 140 952 without coordinates

Open the mapobservation + sensor149 322

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 5≤10 km 17>10 km 22

44 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	12
Copenhagen, DK	10
NSMKlocation not on record	9
New Haven, US	7
Ann Arbor, US	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Toronto, CA	3
Philadelphia, US	3
Barcelona, ES	3
SNSDlocation not on record	2
Seattle, US	2
RBINS-Scientific Heritagelocation not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1
CASlocation not on record	1
Edmonton, CA	1
Brussels, BE	1
Honolulu, US	1
Delaware Museum of Nature and Sciencelocation not on record	1

18 institutions · 68 of 70 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Ardeola bacchus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 12.7–27.8

Seasonal swing summer↔winter15.1 °C

Max temp (day)27.5 °C 13.7–31.2

Min temp (night)19.7 °C 9.70–25.3

Precipitation123 mm/mo 80.9–299

Air humidity59.7 % 52.3–65.9

Moisture balance38.5 mm/mo

Vapour deficit1,327 Pa 664–1,545

Wind speed3.30 m/s

Cloud cover36.7 % 30.7–62.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ardeola bacchus

At a glance

Sources11 archives

Size & morphology14

Life cycle & reproduction5

Diet & foraging8

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type149 412 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type149 412 records