Arcyptera microptera

(Fischer von Waldheim, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Arcyptera

At a glance

Occurrence records367

Data sources4

Biological traits0

DNA specimens79

eDNA detections2

Sources4 archives

Databases and archives Arcyptera microptera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility367 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics79 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF367 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD79 specimens

01Narrative

Arcyptera microptera is een rechtvleugelig insect uit de familie veldsprinkhanen (Acrididae). De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1833 door Fischer von Waldheim.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding79 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcyptera microptera has left across the world's sequence archives.

At a glance

DNA specimens79

BINs2

Marker genes1

eDNA detections2

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P408 bp consensus78 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

3Tmostly conserved

9Amostly conserved

36Cmostly conserved

39Cmostly conserved

49Amostly conserved

60Tmostly conserved

79Tmostly conserved

84Cmostly conserved

94Amostly conserved

99Tmostly conserved

102Amostly conserved

138Cmostly conserved

141Cmostly conserved

153Cmostly conserved

201Cmostly conserved

229Tmostly conserved

270Amostly conserved

300Tmostly conserved

309Gmostly conserved

334Cmostly conserved

396Cmostly conserved

405Cmostly conserved

GTTCCATTAATAATTGGAGCACCAGATATAGCATTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCACCATCATTAACCCTTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes35

BINs2

Most divergent pair6.1%

AsiaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arcyptera labiatasame genus4.2%Arcyptera fuscasame genus4.2%Arcyptera brevipennissame genus4.9%Arcyptera tornosisame genus5.6%Arcyptera coreanasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type367 records

Wild obs. + sensor338

Museum / vouchered27

Other2

Range

Area of Occupancy AOO940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 168≤1 km 43≤10 km 39>10 km 8

258 georeferenced · 80 without coordinates

Open the mapobservation + sensor338

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 22

23 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ORTHATlocation not on record	15
Provincia di Livornolocation not on record	7
Tartu, EE	3
Bavarian State Collection of Zoologylocation not on record	1

4 institutions · 26 of 27 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Arcyptera microptera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.80 °C 0.7–14.8

Seasonal swing summer↔winter27.7 °C

Max temp (day)12.6 °C 6.70–18.5

Min temp (night)2.20 °C -6.00–10.5

Precipitation117 mm/mo 45.0–189

Air humidity54.8 % 49.9–59.6

Moisture balance35.1 mm/mo -26.8–97.0

Vapour deficit570 Pa 437–704

Wind speed3.70 m/s 3.40–3.90

Cloud cover42.4 % 41.3–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)