Arcyptera brevipennis

(Brunner von Wattenwyl, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Arcyptera

At a glance

Occurrence records153

Data sources5

Biological traits0

DNA specimens5

eDNA detections0

Sources5 archives

Databases and archives Arcyptera brevipennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF153 records

DNA & barcodingBOLD5 specimens

01Narrative

Arcyptera brevipennis is een rechtvleugelig insect uit de familie veldsprinkhanen (Acrididae). De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1861 door Brunner von Wattenwyl.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcyptera brevipennis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P710 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes1

BIN1

Where individuals differ — all 13 variable positions, in barcode order

57Cvariable

58Tvariable

60Gvariable

90Tvariable

125Gvariable

144Tvariable

195Tvariable

198Tvariable

331Avariable

378Tvariable

454Cvariable

459Gvariable

690Cvariable

TTCTCAACAAACCATAAGGATATTGGCACTTTATATTTTATATTTGGAGCATGAGCCTGGATAGTAGGAACATCAATAAGTATAATTATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arcyptera labiatasame genus1.6%Arcyptera tornosisame genus3.3%Arcyptera meridionalissame genus3.7%Arcyptera micropterasame genus4.9%Arcyptera coreanasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor146

Museum / vouchered1

Other6

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 30≤1 km 4≤10 km 13>10 km 78

125 georeferenced · 21 without coordinates

Open the mapobservation + sensor146

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Zoologisches Forschungsmuseum Alexander Koeniglocation not on record	1

1 institutions · 1 of 1 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)