Arcygobius baliurus

(Valenciennes, 1837) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Arcygobius

At a glance

Occurrence records149

Data sources9

Biological traits7

DNA specimens39

eDNA detections13

Sources9 archives

Databases and archives Arcygobius baliurus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

OBISOcean Biodiversity Information System104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS149 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD39 specimens

01Narrative

The Isthmus goby (Arcygobius baliurus) is a species of goby native to marine and brackish waters of the Indian Ocean and the western Pacific Ocean where it can be found at depths of from 3 to. This species lives on substrates consisting of a mix of sand and rubble. This species grows to a length of 10.2 cm SL. This species is the only known member of its genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10.16 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max15 m

Depth min3 m

Vulnerability10

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arcygobius baliurus has left across the world's sequence archives.

At a glance

DNA specimens39

BINs5

Marker genes1

eDNA detections13

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

13Cmostly conserved

16Cmostly conserved

22Cmostly conserved

46Avariable

62Cmostly conserved

70Gvariable

94Gvariable

106Avariable

109Cmostly conserved

115Cmostly conserved

119Gvariable

169Cvariable

181Gvariable

214Tvariable

256Tvariable

265Cmostly conserved

284Cmostly conserved

287Cmostly conserved

319Gvariable

325Cvariable

343Amostly conserved

361Avariable

367Gvariable

376Tvariable

391Tvariable

400Tmostly conserved

424Cvariable

425Cvariable

427Gvariable

445Tvariable

451Avariable

454Tmostly conserved

478Tvariable

484Gvariable

493Avariable

514Amostly conserved

532Cvariable

536Tvariable

538Avariable

553Cvariable

565Avariable

598Tvariable

622Gvariable

625Cvariable

CCTTTACCTAGTCTTCGGTGCCTGGGCCGGAATAGTAGGCACAGCACTAAGCCTGCTTATTCGAGCAGAGCTTAGCCAACCTGGCGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes15

BINs5

Most divergent pair5.2%

AsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblygobius stethophthalmussame family16.0%Erythrocles schlegeliisame order16.1%Evorthodus minutussame order16.4%Erythrocles monodisame order16.4%Plagiogeneion macrolepissame order16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type149 records

Wild obs. + sensor6

Museum / vouchered142

Other1

Range

Area of Occupancy AOO200 km²

Depth

0–200 m sunlit17

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.6 m · max 66 m · 17 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 5 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 13≤1 km 17≤10 km 20>10 km 11

61 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	14
CASlocation not on record	10
Sydney, AU	3
Natick, US	2
Museum and Art Gallery of the Northern Territorylocation not on record	2
Australian National Fish Collectionlocation not on record	2
South African Institute for Aquatic Biodiversitylocation not on record	2
Toronto, CA	1
Kagoshima University Museumlocation not on record	1
Frankfurt am Main	1
Western Australian Museumlocation not on record	1

11 institutions · 39 of 142 vouchered records shown · 4 without an institution code

09Environmental DNA13 detections

Where the DNA of Arcygobius baliurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 24.8–27.2

Seasonal swing summer↔winter2.80 °C

Max temp (day)29.9 °C 27.2–29.9

Min temp (night)24.1 °C 22.0–24.1

Precipitation192 mm/mo 41.3–192

Air humidity63.9 % 62.0–64.4

Moisture balance28.0 mm/mo

Vapour deficit1,312 Pa 1,153–1,312

Wind speed2.70 m/s

Cloud cover35.5 % 18.5–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)