Arctosa raptor

(Kulczyński, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records153

Data sources8

Biological traits3

DNA specimens50

eDNA detections48

Sources8 archives

Databases and archives Arctosa raptor's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 2 countries48 detections

DNA & barcodingBOLD50 specimens

01Narrative

Arctosa raptor is a species of wolf spiders in the family Lycosidae. It is found in Russia, Nepal, the USA, and Canada.Dean DA (2016). "Catalogue of Texas spiders". ZooKeys 570: 1-703.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀13.5·♂9.85 mm

Cephalothorax length♀5.59·♂4.97 mm

Cephalothorax width♀4.32·♂3.71 mm

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa raptor has left across the world's sequence archives.

At a glance

DNA specimens50

BINs1

Marker genes1

eDNA detections48

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

214Amostly conserved

433Amostly conserved

514Gmostly conserved

550Tmostly conserved

616Cmostly conserved

619Tmostly conserved

625Gmostly conserved

646Tmostly conserved

GACTTTATATTTAATATTTGGTGTTTGATCTGCTATAGTAGGAACTGCTATAAGAGTGTTAATTCGACTTGAGTTAGGACATTCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes7

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa ebichasame genus8.2%Allotrochosina schauinslandisame family9.4%Agalenocosa punctatasame family9.6%Diapontia anfibiasame family9.6%Hygrolycosa rubrofasciatasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor25

Museum / vouchered128

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15≤1 km 4

19 georeferenced · 6 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 6

7 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	29
Espace pour la vielocation not on record	24
University of Alberta Museums (UAM)location not on record	16
Edmonton, CA	5
Cambridge, US	3
WIlocation not on record	2
Denver, US	1
Royal Saskatchewan Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
University of Alaska Museumlocation not on record	1

10 institutions · 83 of 128 vouchered records shown · 45 without an institution code

09Environmental DNA48 detections

Where the DNA of Arctosa raptor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map2 countries0

BogWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 1.00–15.5

Seasonal swing summer↔winter37.0 °C

Max temp (day)15.0 °C 5.90–21.5

Min temp (night)8.10 °C -3.80–9.60

Precipitation69.7 mm/mo 45.8–157

Air humidity59.8 % 52.1–63.0

Moisture balance-40.5 mm/mo -85.9–68.2

Vapour deficit500 Pa 244–840

Wind speed3.10 m/s 2.80–7.90

Cloud cover43.4 % 39.2–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)