Allotrochosina schauinslandi

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Allotrochosina

At a glance

Occurrence records240

Data sources6

Biological traits0

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Allotrochosina schauinslandi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility240 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF240 records

DNA & barcodingBOLD3 specimens

01Narrative

Allotrochosina schauinslandi est une espèce d'araignées aranéomorphes de la famille des Lycosidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allotrochosina schauinslandi has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTAATATTTGGAGTATGGGCTGCTATAATTGGAACTGCTATAAGAGTTTTAATTCGGATAGAATTAGGACATTCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa raptorsame family9.4%Pisaura noviciasame order9.7%Oxyopes licentisame order9.7%Diapontia anfibiasame family9.7%Agalenocosa tricuspidatasame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor228

Museum / vouchered12

Range

Area of Occupancy AOO644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 103≤1 km 63≤10 km 14>10 km 7

187 georeferenced · 41 without coordinates

Open the mapobservation + sensor228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 11

11 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	11
	1

2 institutions · 12 of 12 vouchered records shown